ライフサイエンスコーパス: deprotect

1 l pyruvates were formed and finally globally deprotected.

2 urther cross coupling reactions, and readily deprotected.

3 the bicyclic ring system and can be readily deprotected.

4 ic external protein segments become strongly deprotected.

5 ed to a near-UV laser is used to selectively deprotect 2-nitrophenylpropyloxycarbonyl (NPPOC)-protect

6 , while trifluoroacetic acid was required to deprotect 2e and afford 1.

7 Compound 36 was converted to the fully deprotected 6-azido-GlcN (37) and 2,6-diaminoglucose (38

8 Reactions of the 5'-deprotected 6-ClP-riboside with alkyl amines proceeded i

9 sing link" carboxylesterase that selectively deprotects a late-stage intermediate, so triggering more

10 Once the ligand is deprotected, a conformational change generates a similar

11 les, the present method was also extended to deprotect acetonides obtained from 1,2-, and 1,3-termina

12 resulting iminium intermediate by an in situ-deprotected alcohol.

13 re reacted with ethylenediamine, whereas the deprotected alkyne functions of 2 were self-reacted by E

14 amolecular displacement of a mesylate by the deprotected amine.

15 The synthesis was performed via 3a and the deprotected amines 5a, 13, and 19, including three repea

16 Each of the deprotected amines was isolated without chromatography u

17 liminates the cumbersome steps of protecting/deprotecting amino or hydroxy groups.

18 conditions to grant access to selectively O-deprotected aminosugars amenable for further derivatizat

19 nexpectedly, cohered sister telomeres become deprotected and are inappropriately fused.

20 These compounds were subsequently deprotected and converted into the 2'-O-[2-[(methyleneam

21 Such microbeads that can be sequentially deprotected and converted to NO release particles via in

22 The silanyloxy esters were efficiently deprotected and coupled to the C2-C10 amino acid fragmen

23 obtained from the N-benzylation reaction was deprotected and coupled with diethyl l-glutamate followe

24 4, the ester obtained from the reaction was deprotected and coupled with diethyl L-glutamate followe

25 The esters obtained from the reaction were deprotected and coupled with diethyl-l-glutamate followe

26 midt conditions afforded a chalcone that was deprotected and cyclized in the presence of sodium aceta

27 -protected beta-amidoalcohols can be in situ deprotected and dehydrated to give 2-oxazolines in good

28 are associated with increased frequencies of deprotected and fragile telomeres.

29 osphine-substituted boronate esters could be deprotected and isolated in pure form.

30 Five examples were then deprotected and screened for their efficacy as enzyme in

31 urther modification of the termini gives the deprotected and stannylated compounds RC4-Fe(depe)2-C4-F

32 The unique surface sites can be deprotected and subjected to additional chemistries.

33 Compound 3a was deprotected and the resultant nucleoside used to prepare

34 The resulting phosphine-boranes were deprotected and used as reagents in the desymmetrizing a

35 e C-H-activated functionalization instead of deprotecting and/or throwing away the directing groups.

36 Data suggest they are taken up, are deprotected, and are converted to a potent inhibitory fo

37 (8) or di-n-propyl (9), have been prepared, deprotected, and peripherally metalated with molybdocene

38 The fully deprotected anomeric aminooxy GM3 trisaccharide was then

39 mpact on the rates at which such termini are deprotected as a prelude to RNA degradation could have m

40 RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to thos

41 rom controlled-pore glass supports and fully deprotected by ammonia or methylamine under gas phase co

42 Each of the latter was globally deprotected by catalytic (Pd/C) hydrogenation/hydrogenol

43 protected segment at -107 to -99 that can be deprotected by coincubation with molar excess of a conse

44 The protected amides were then smoothly deprotected by heating with ethylenediamine derivatives,

45 ide, the prepared N-benzyl tetrazoles can be deprotected by hydrogenolysis to form the corresponding

46 6(II)-cyclic phosphates, which were globally deprotected by one-step catalytic (Pd/C) hydrogenation/h

47 he elaborated proteins could subsequently be deprotected by photolysis.

48 Finally, the epitope is deprotected by removal of the mAb.

49 The Dma group is then deprotected by treatment with ammonia in methanol.

50 The ligated glycopeptides can be smoothly deprotected by UV irradiation.

51 nation pathways implicated in these fusions, deprotected chromosome ends will instead be eroded by nu

52 These groups can be deprotected cleanly and in high yield by irradiation fro

53 ; final acidic hydrolysis afforded the fully deprotected compounds as their TFA salts.

54 elected so that the antenna of the resulting deprotected compounds could be selectively extended by g

55 All of the deprotected compounds were screened for inhibition of HC

56 analogues 3 and 4, the ester precursors were deprotected, coupled with diethyl-L-glutamate, and sapon

57 After the metal ions were removed, the deprotected cysteines were then available to specificall

58 c chemistry that are heavily used to protect/deprotect different functionalities.

59 Capture of nucleobase- and phosphate-deprotected DNA sequences released from the synthesis su

60 tution on the thioxanthyl backbone were also deprotected efficiently with irradiation at 350 nm.

61 pha-GalPhyt intermediate can be orthogonally deprotected, enabling selective manipulation at either t

62 of their diverse stereochemical attributes, deprotected enyne analogues 5a, 6a, 9a, and 13 derived f

63 ormer-specific in either of its protected or deprotected forms, which is a unique property of this pr

64 ve range of protecting groups, even in their deprotected forms.

65 We found that oocytes deprotected from their surrounding layer of follicular c

66 by sulfation of the resulting alcohol(s) and deprotecting gave several ganglio-oligosaccharides.

67 The deprotected guanidines were subsequently regioselectivel

68 The deprotected guanidinium is configurationally stable unde

69 hich facilitated the generation of the fully deprotected HA decasaccharide.

70 The deprotected heptasaccharide 1 was coupled to a poly[N-(a

71 The protected substrates were deprotected in 1:1 water:acetonitrile with irradiation a

72 r or a protected form of ammonia that can be deprotected in a subsequent synthetic step.

73 HPLC, and each diastereomer was subsequently deprotected in acidic conditions.

74 ol , a triacylglycerol that was conveniently deprotected in ethanol with acrylic beads containing Can

75 nantioenriched allylic amide products can be deprotected in good yield to give enantioenriched allyli

76 benzylated N-sulfonylphosphoramidates may be deprotected in one step to give the free acids in quanti

77 succinimide products obtained can be easily deprotected in situ (if desired) to reveal the correspon

78 hiol and an additional disulfide linkage are deprotected in situ and trapped with an activated thioph

79 groups were explored, the latter of which is deprotected in situ to yield the free catechol.

80 In alternate steps, the resin is deprotected in situ with TBAF and coupled to the 3-bromo

81 Aromatic acetates can be selectively deprotected in the presence of aliphatic acetates under

82 by biosynthetic cyclization, it combines the deprotected linear biosynthetic precursor peptide sequen

83 Completely deprotected, modified oligodeoxynucleotides were purifie

84 r RNA sample composed of 320-640 nmol of the deprotected nucleoside.

85 pportive in both sequential and simultaneous deprotecting of OPAc, Bz, and Ac.

86 ces, depurination products, and incompletely deprotected oligonucleotides, linkage isomers may form d

87 ut not to identify and quantify incompletely deprotected oligonucleotides.

88 Furopyrimidine was deprotected or simultaneously converted into pyrrolopyri

89 This hydrosilyl directing group is readily deprotected or transformed to other functional groups af

90 hydrous hydrogen fluoride used to cleave and deprotect peptides after solid-phase peptide synthesis.

91 Globally deprotected peptides containing phenylselenocysteine can

92 eomer, and free homoallylamine affording the deprotected piperidine as single cis diastereomer.

93 We present a method, called protect, modify, deprotect (PMD), to generate immunogenic proteins aimed

94 On the basis of circular dichroism, the deprotected polymer possesses a regular secondary struct

95 Protected and deprotected polymers and model compounds are characteriz

96 The deprotected products are obtained in moderate to good ov

97 of the DMPBn ether giving the corresponding deprotected products in moderate to high yields.

98 nveniently and quantitatively converted into deprotected pyrrole-3-carboxylic esters 5 by a simple ba

99 and subsequent oxidation affords 31 and the deprotected quinone alcohol 34.

100 anethiol, is the easy extraction of both the deprotecting reagent and the byproduct 2-(diethylamino)e

101 d as an easy, mild, selective, and efficient deprotecting reagent for their removal in the perspectiv

102 neutral conditions at 65 C to provide fully deprotected RNA sequences in marginally better yields th

103 orthogonal N-protecting groups, which can be deprotected selectively.

104 as established by constructing the partially deprotected single glycan chain containing glycopeptides

105 k on 17 leads directly to the isolation of N-deprotected substitution products (with concomitant deca

106 vancomycin aglycon (7), conducted on a fully deprotected substrate, are disclosed.

107 near sequence by using an otherwise globally deprotected substrate.

108 ctionalization was extensive, with the NPPOC-deprotected surfaces and aminopropylsiloxane control mat

109 n as TERF2) from mouse cells (TRF2(fl/-)) to deprotect telomeres, which, like double-strand breaks, a

110 We show that loss of APE2 inhibits MMEJ at deprotected telomeres and at intra-chromosomal DSBs and

111 was identified based on its association with deprotected telomeres and localized to sites of DNA dama

112 Imaging showed that deprotected telomeres are more mobile and sample larger

113 TM signaling, ATR signaling, NHEJ, and HR at deprotected telomeres can take place in the absence of o

114 Also unlike genomic breaks, we found that deprotected telomeres do not contribute to the G2/M chec

115 We found that, unlike genomic breaks, deprotected telomeres that are recognized as DNA damage

116 Deprotected telomeres undergo changes in chromatin struc

117 hromatin segments (PICh) technique to purify deprotected telomeres, PHF11 was enriched as cells mount

118 and recruit 53BP1 (also known as TP53BP1) to deprotected telomeres, the 3' telomeric overhang persist

119 arising from either critically shortened or deprotected telomeres.

120 damaged chromatin dynamics at both DSBs and deprotected telomeres.

121 species (ROS), Sir protein perturbation, or deprotected telomeres.

122 n modulating the structure and processing of deprotected telomeres.

123 joining recombination proteins for access to deprotected telomeres.

124 The coupling product 91 was deprotected (tert-butylhydrogen peroxide, trifluoroaceti

125 unctions without the need for an additive to deprotect the alkynyl carbon as endstanding anchor group

126 -hexafluoroisopropanol [HFIP] to selectively deprotect the N-benzyloxycarbonyl group (N-Cbz).

127 from deprotonation in the free enzyme while deprotecting the catalytic triad as a whole when in the

128 degraded at cancer sites by the enzyme, thus deprotecting the tumour and allowing prolonged antimetab

129 l organization of telomeres that have become deprotected through the deletion of the shelterin compon

130 ed version of 2-thioglyceraldehyde 13 can be deprotected to a useful form of this aldehyde.

131 lly, the TMS-acetylene unit has been cleanly deprotected to afford a terminal alkyne in the presence

132 lenes can be cyclized to 2-oxazolidinones or deprotected to afford the free amines which can be cycli

133 ear tetrabenzyl-protected trihydroxamate was deprotected to afford the natural product Danoxamine.

134 ated, phospholipidated, and finally globally deprotected to afford the target molecule.

135 sible aldol adducts, which were oxidized and deprotected to complete the synthesis of (-)-berkelic ac

136 accharides have been partially or completely deprotected to create 29 more structures to further incr

137 ed to 6-(het)aryl-deazapurine derivatives or deprotected to free phosphonic acids.

138 d linked to Asn, the carbohydrate moiety was deprotected to give 12.

139 rivatives 28 and 29 which were separated and deprotected to give 14 and 16.

140 ly reduced using sodium borohydride and then deprotected to give allo- and epi-inositol in good yield

141 ation all isomers 24a-24d were separated and deprotected to give aminospiropentane hydrochlorides 25a

142 The MEDAM imines can be deprotected to give N-H aziridines in all cases except f

143 These intermediates were deprotected to give the 6'-chloro 3a, 6'-bromo 3b, and 6

144 ished in a facile manner, which was globally deprotected to give the Fuc-GM(1) glycoside 1.

145 yclic derivatives 11a-d and 19 produced were deprotected to give the new kainoid amino acids 6a-d and

146 Finally, the GPI-anchored peptide was deprotected to give the target molecule 1.

147 rnish silylated hydroperoxides, which can be deprotected to homologated hydroperoxides.

148 sor was cyclized off-resin and then globally deprotected to obtain A5D.

149 The carbomethoxy groups were deprotected to obtain carboxylic groups used to immobili

150 henium metal was subsequently photolytically deprotected to obtain the macrocycle 1.

151 ally, protected amines are employed and then deprotected to realize amination, but this strategy limi

152 e rearranged with strong base, oxidized, and deprotected to the desired o-carboxybenzophenones.

153 ntrol, forming beta-imino amides that can be deprotected to the primary beta-amino amide or reduced t

154 The silyloxymethylsulfinate can be deprotected to then form sulfonyl fluorides, sulfonamide

155 atives, which were fluorinated with DAST and deprotected to yield 2,5, 6-trichloro-1-(2-deoxy-2-fluor

156 The boronic ester-polyesters are deprotected to yield boronic acid- and borate-polyesters

157 hydantoins may be hydrolyzed and oxidatively deprotected to yield hydantoins and unsaturated alpha-qu

158 After pyrophosphorylation, the material is deprotected to yield N(6)-(2-aminoethyl)-2'-deoxyadenosi

159 nt was obtained, and some of them were fully deprotected to yield original iminosugar C-glycosides.

160 er separation, the beta-isomers were further deprotected to yield the target nucleosides.

161 upports because of its ability to cleave and deprotect under mild conditions in standard reagents.

162 l protected triazabutadienes (pTBD) that are deprotected under basic conditions of the larval midgut,

163 nzylidene acetals, which can be conveniently deprotected under mild acidic conditions to grant access

164 was circumvented when oligonucleotides were deprotected under mild conditions (aq ammonia-EtOH, rt).

165 phyrins and multiporphyrin arrays yet can be deprotected under mild conditions (TMS-Cl/TEA or TMS-Br/

166 ates during the synthesis and can be cleanly deprotected under mild conditions.

167 Acetals and ketals are readily deprotected under neutral conditions in the presence of

168 otected pyrrolidines, which could be readily deprotected under standard conditions.

169 Thioketal groups were deprotected upon reaction with mercury oxide and aqueous

170 uflonyl-1-arylisoindolinones, which can be N-deprotected using samarium iodide to generate the free 1

171 charide isolated in 47% yield, which is then deprotected using standard procedures to provide fucosyl

172 -dioxides) were synthesized and subsequently deprotected using trifluoroacetic acid.

173 nvolving pinacol boronate esters, which were deprotected via a two-stage procedure involving intermed

174 d five-mer oligonucleotides were efficiently deprotected where all other conditions failed.

175 )-8'-(trimethylsilyl)enynes 8a,b, which were deprotected with aqueous trifluoroacetic acid to give th

176 The acid labile carbamate 2d was deprotected with HCl/AcOH to provide 1, while trifluoroa

177 The silyloxyamino group can be deprotected with tetrabutylammonium fluoride to yield hy

178 6 with acid chloride 38d gave 39d, which was deprotected with TFA and then mild base to give 8 in 45%

179 ligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C i

180 y protecting groups that can be installed or deprotected without affecting other functional groups pr