ライフサイエンスコーパス: first intron

1 excessive expansion of GAA repeats into its first intron.

2 similar CTCF-cohesin binding site within the first intron.

3 o well-conserved E box elements in the large first intron.

4 the VGLUT1 upstream promoter and the VGLUT1 first intron.

5 '-untranslated region (5'-UTR) including the first intron.

6 than 10,000 genes and show a bias toward the first intron.

7 3'-alternative splice site selection of the first intron.

8 transcription initiation site and within the first intron.

9 from the transcription start) or within the first intron.

10 se element and a Sp1 site located within the first intron.

11 T-cells-c2 to consensus sequences within the first intron.

12 alternative 3' splice site selection in the first intron.

13 he UG repeats near the 3'-splice site in the first intron.

14 ent in the promoter and sequences within the first intron.

15 ents in the proximal promoter and within the first intron.

16 an extended promoter construct spanning the first intron.

17 itional factors, C/EBP and USF, bound in the first intron.

18 w start codon is in the previously annotated first intron.

19 tor sequence located 1100 bp upstream of the first intron.

20 e for the promoter-enhancing activity of the first intron.

21 e Gld is activated by an enhancer within the first intron.

22 /HAF1 at -182, the latter three being in the first intron.

23 h overlaps with the splice donor site of the first intron.

24 on-sensitive manner to sites within the BCL6 first intron.

25 ighly inducible binding to a site within the first intron.

26 ne via a conserved STAT3-binding site in the first intron.

27 ivation of a regulatory element in the SMAD3 first intron.

28 hin upstream or intronic regions, especially first introns.

29 am and downstream of coding sequences and in first introns.

30 at cryptic cleavage/polyadenylation sites in first introns.

31 lly affecting selection of 5' splice site of first introns.

32 ired an E-box cis-element located within the first intron (+2,627) of the N-cadherin gene.

33 a stretch of 110 bases immediately 5' to the first intron 23 bp upstream of the ATG start codon is re

34 egion of the promoter or substitution of the first intron abolished ischemia-induced MMP-2 transcript

35 -flanking sequences, the first exon, and the first intron activated expression in endothelial cells o

36 mutagenesis of the splice donor site of the first intron affects both correct splicing and transcrip

37 In one line, hAFP was introduced into the first intron after the translational start codon; in the

38 also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds

39 ng the promoter, some enhancers, first exon, first intron and a small part of the second exon of UBC.

40 aposed to two other sites located within the first intron and downstream of Ifng, where CTCF, cohesin

41 CF consensus binding elements located in the first intron and downstream of the IRS1 transcriptional

42 and Shahdara identified two deletions in the first intron and immediately downstream the gene in Bay-

43 ivates expression of ndr2 via binding to its first intron and is required for ndr2 expression in the

44 ecause it contains a bona fide p53 bs in its first intron and its expression highly correlates with T

45 pression of PP2A by binding to a site in the first intron and modulating chromatin modifications at t

46 By combining first intron and promoter interactions, we found that ge

47 d to an E-box-containing region in the PEG10 first intron and site-directed mutagenesis showed that t

48 s were also spliced between the donor of the first intron and the acceptor of the second intron.

49 esulting in alternative splicing in both the first intron and the last intron.

50 d probes, one spanning an exceptionally long first intron and the other spanning exons, we identify t

51 eeds: two positive regulatory regions in the first intron and the sequence between -425 and -207, and

52 a candidate motif that is overrepresented in first introns and whose occurrence in tested introns is

53 some 17 (403A in the promoter, In1.1C in the first intron, and 3'222C in the 3' untranslated region)

54 E) in the promoter region and an ISRE in the first intron, and is induced by the IFN-triggered Jak-ST

55 f the TSS, G-richness is concentrated in the first intron, and on the nontemplate strand, where polym

56 that differ with respect to splicing of the first intron are detected, there is no indication that t

57 TFs that bind first introns are largely different from those binding p

58 First introns are longer than other introns in multiple

59 icularly those for families enriched in long first introns, are more conserved in length, have more c

60 We found that deletion of sequences in the first intron between +653 and +744 decreased the T3 indu

61 The first intron between the first exon and the exon with th

62 eron-stimulated response element site in the first intron binds interferon-stimulated gene factor 3 (

63 preferentially located towards the 5'-end of first introns but also appear to be enriched in 5'-UTRs

64 tion of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector

65 both in isolation and in the context of the first intron conferred p53-dependent transcriptional act

66 ies indicate that the 3.13-kilobase promoter/first intron confers essentially normal CSF-1 expression

67 Pbeta was driven by a 3.6-kb Col1a1 promoter/first intron construct, and four transgenic (TG) mouse l

68 sing a 56-bp region of the mouse alpha-actin first intron containing SRF, NFAT, and AP-1 sites (SNAP)

69 First, intron-containing pre-mRNAs in yeast are detectab

70 The first intron contains both positive and negative regulat

71 two introns; non-canonical sequences in the first intron contribute to its retention, a common form

72 er, whereas in barley, mutations in the HvFT first intron differentiate plants with dominant and rece

73 e show that the VGLUT1 upstream promoter and first intron each support glutamatergic-specific express

74 the transcription start site and 5' ends of first introns (false discovery rate < 0.001) of genes do

75 The ability of the first introns from both the TRP1 and POLYUBIQUITIN10 (UB

76 The VGLUT1 upstream promoter or the first intron, fused to the basal promoter, each supporte

77 Inclusion of the first intron had no effect on promoter activity.

78 scription start site (most frequently in the first intron), have multiple GATA1-occupied segments tha

79 tive sites in the 5'-flanking region and the first intron in all three cells correlated with relative

80 ical retinoic acid-responsive element in the first intron in the IGFBP-6 gene adjacent to a consensus

81 Here we explore the importance of first introns in TF binding in the nematode Caenorhabdit

82 We also describe the first introns in this deep-branching lineage.

83 s-regulatory elements in introns (especially first introns) in genes under strong selective constrain

84 a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts d

85 iate early (MIE) transcripts initiate in the first intron, intron A, of the previously defined MIE tr

86 In these mouse lines, the first intron is required for T3 induction as well as hig

87 urthermore, we show that cis-splicing of the first intron located in downstream positioned genes in t

88 anscriptional splicing is less efficient for first introns, longer introns, and introns annotated as

89 ase I-hypersensitive site in HL60 DNA in the first intron may be related to the high serglycin expres

90 s question more thoroughly, sequences of the first intron of a single copy nuclear gene, PISTILLATA,

91 l stop cassette (neostop) located within the first intron of a target gene.

92 STAiR2 originates from the first intron of a tumor suppressor gene.

93 We identify rs651007 (MAF=20%) in the first intron of ABO at the putative promoter of an antis

94 redefined regulatory elements and within the first intron of all genes.

95 which a gene trap has been inserted into the first intron of annexin IV.

96 gion of mouse/human sequence homology in the first intron of Bcl-6, which is a candidate site for suc

97 l STAT-binding regions in the first exon and first intron of BCL6 that fell within regions of high in

98 nd bound to a Thpok-responsive region in the first intron of Bcl6.

99 In mouse and human, the first intron of Blcap/BLCAP contains the distinct Neuron

100 e GAA-repeat expansion is present within the first intron of both FRDA alleles, that results in trans

101 ying a conserved p53 response element in the first intron of both the human and the murine bax genes.

102 a2b region, a bona fide AID target, into the first intron of c-myc.

103 utations is a GGGGCC repeat expansion in the first intron of C9ORF72 As shown by recent intensive stu

104 A hexanucleotide repeat expansion in the first intron of C9ORF72 has been shown to be responsible

105 anucleotide (GGGGCC) repeat expansion in the first intron of C9ORF72 on the affected haplotype.

106 ently, an expansion of GGGGCC repeats in the first intron of C9orf72 was found to be a common cause o

107 anucleotide (GGGGCC) repeat expansion in the first intron of C9ORF72, a gene located on chromosome 9p

108 tains a 3,444-bp transposon insertion in the first intron of CAD2 gene.

109 sion through RBP-Jkappa binding sites in the first intron of CD21 and in the CD23a core promoter, res

110 ion of the unique open chromatin site in the first intron of COL1A2 using a transgenic mouse model.

111 genome in which the 5'-UTR, first exon, and first intron of COX1 are fused to the fourth codon of AT

112 ectly to cis-regulatory sequences within the first intron of CSE to activate transcription.

113 ative Klf5 binding sites in the promoter and first intron of Dmp1 and Dspp genes that are homologous

114 e effect of Klf5 on Dspp activity was in the first intron of Dspp gene.

115 e identified a cis-regulatory element in the first intron of dSUR, which contains Tinman consensus bi

116 ed Mtg16 near an E2A binding site within the first intron of E2F2.

117 , caused by insertion of a promoter into the first intron of each gene, leads to NF-kappaB-dependent

118 onsensus binding sequence in the promoter or first intron of Eig3, E2F regulation may be indirect.

119 The first intron of eno2 was spliced with high fidelity and

120 a well described polymorphic sequence in the first intron of ERalpha (PvuII and XbaI) has a key role

121 shows that the trap vector is located in the first intron of Fem1c, a gene homologous to the sex-dete

122 We have identified a 1.7-kb region in the first intron of Fgf10 that is necessary and sufficient t

123 e conservation identified regions within the first intron of Foxn1 that possessed the characteristics

124 SNPs in the first intron of FTO (fat mass and obesity associated) ar

125 hat the obesity-risk allele rs8050136 in the first intron of FTO alters a regulatory element recogniz

126 The first intron of FTO contains common single nucleotide po

127 Variants located in the first intron of FTO were unequivocally associated with a

128 on of triplex-forming GAA/TTC repeats in the first intron of FXN gene results in Friedreich's ataxia.

129 ledge that a GAA.TTC repeat expansion in the first intron of FXN induces heterochromatin, we previous

130 s GAA trinucleotide repeat expansions in the first intron of FXN occur in 96% of affected individuals

131 d results from an expanded GAA repeat in the first intron of FXN.

132 MIST1 bound CATATG/CAGCTG E boxes in the first intron of genes that regulate autophagosome/lysoso

133 found primarily in or near the 5'-UTR or the first intron of genes, and seldom in the intergenic regi

134 e nucleotide polymorphisms (SNPs) within the first intron of HLA-DRA1.

135 directly binding to the E-box element in the first intron of HP1gamma gene, and the upregulated HP1ga

136 spring accessions contain a deletion in the first intron of HvBM5A that may be important for regulat

137 s transcribed from a promoter present in the first intron of LEF1 gene and undergoes splicing in mese

138 phism within a super-enhancer element in the first intron of LMO1 influences neuroblastoma susceptibi

139 etylation of histone H3 lysine 27 within the first intron of LMO1.

140 The transcription factor MIST1 bound the first intron of Mib1 and regulated its expression.

141 ization of a tissue-specific enhancer in the first intron of murine Nfatc1 that activates a heterogen

142 ed switch mu region, S mu, were found in the first intron of Myc in lymph node cells of IL-6 transgen

143 Furthermore, the splicing efficiency of the first intron of nad2, encoding for another complex I sub

144 dentified a transposon insertion site in the first intron of Nmnat2 (Nicotinamide mononucleotide aden

145 ta, FLCD maps to a structural variant in the first intron of pdm3; however, this variant is not found

146 e that is repeated multiple times within the first intron of Peg3 in all three mammals.

147 factor Ikaros binds to a variant site in the first intron of PP2A and modulates its expression.

148 by inserting a core Sgamma1 region into the first intron of proto-oncogene Bcl6, which is a non-Ig t

149 iquitously expressed gene located within the first intron of Runx2.

150 ression of S100A4 and hypomethylation of the first intron of S100A4 was statistically significant (P

151 an expansion of an ATTTC pentamer within the first intron of STARD7.

152 which reduce its binding to sites within the first intron of stathmin-2 pre-messenger RNA, uncover a

153 ining the 5' region of the p23 gene into the first intron of Tbx10, which causes ectopic expression o

154 directly bound to two strong E-boxes in the first intron of Tead2 by chromatin immunoprecipitation a

155 pha, an intronless gene, rearranges with the first intron of TFEB, just upstream of TFEB's initiation

156 p enhancer located at position + 23.5 in the first intron of the 224-kb mouse Runx1 gene.

157 G-quadruplex-forming sequence (PQFS) in the first intron of the Atg7 gene folds into a G4.

158 gly, the deletion of the P1BS motif from the first intron of the barley 5'-UTR led to a significant i

159 ly located AP1 binding sites residing in the first intron of the BCSG1 gene.

160 binding sites, 5'-AAGTG, and is part of the first intron of the Beadex gene.

161 a kappaB cis-DNA element located within the first intron of the bic gene.

162 cludes additional regulatory elements in the first intron of the Bim gene.

163 One CNS located in the first intron of the c-fos gene conferred regulation by c

164 The variant rs26232, in the first intron of the C5orf30 locus, is associated with th

165 ansions of a non-coding GGGGCC-repeat in the first intron of the C9orf72 gene are a common cause of b

166 Expanded GGGGCC repeats in the first intron of the C9orf72 gene represent the most comm

167 GGGCC hexanucleotide repeat expansion in the first intron of the C9ORF72 gene.

168 functional INE (intronic element) within the first intron of the Cat-1 gene was identified and charac

169 through a paired-domain DNA sequence in the first intron of the CCN3 gene.

170 A silencer element within the first intron of the CD4 gene is sufficient for CD4 trans

171 by a transcriptional silencer located in the first intron of the CD4 locus.

172 (CEB-MARE), from +2,628 to +2,641 bp in the first intron of the CHOP gene, activates it.

173 The variant rs26232, in the first intron of the chromosome 5 open reading frame 30 (

174 ent in the CPT-I alpha gene promoter and the first intron of the CPT-I alpha gene.

175 ha-luciferase transgenes with or without the first intron of the CPT-Ialpha gene.

176 identified a p53-binding site (p53BS) in the first intron of the DcR2 gene.

177 is almost identical to the one found in the first intron of the DR5 gene in terms of their locations

178 loma cell lines, recruitment of c-Rel to the first intron of the Ezh2 locus promoted Ezh2 mRNA expres

179 s, we identified a cis-acting element in the first intron of the flk1 gene that is required for endot

180 y conserved STAT-binding site located in the first intron of the FOXP3 gene.

181 Expansion of a GAA . TTC repeat in the first intron of the frataxin (FXN) gene causes an mRNA d

182 d by the expansion of GAA.TTC repeats in the first intron of the frataxin (X25) gene.

183 Expansions of (GAA)n repeats within the first intron of the frataxin gene reduce its expression,

184 expansion of a GAA.TTC triplet repeat in the first intron of the frataxin gene.

185 ed by expansions of the (GAA)n repeat in the first intron of the frataxin gene.

186 GAA triplet-repeat (GAA-TR) sequence in the first intron of the FRDA gene.

187 presence of expanded (GAA)(n) repeats in the first intron of the FXN gene [V.

188 pansion of an unstable GAA.TTC repeat in the first intron of the FXN gene causes Friedreich ataxia by

189 Expansion of the GAA/TTC repeats in the first intron of the FXN gene causes Friedreich's ataxia.

190 rexpansion of GAA*TTC repeats located in the first intron of the FXN gene, which inhibits transcripti

191 e triplet-repeat sequence GAA.TTC within the first intron of the FXN gene.

192 ssociated with a GAA repeat expansion in the first intron of the gene (FRDA) encoding a novel, highly

193 emly repeated, transposable element into the first intron of the gene cortex.

194 pansion of a trinucleotide repeat within the first intron of the gene that encodes frataxin.

195 ich negative regulatory (PNR) element in the first intron of the gene, which is essential for its car

196 ghly conserved FOXO binding sites within the first intron of the gene.

197 sis of an existing P-element inserted in the first intron of the gene.

198 lements, two in the 5' region and one in the first intron of the gene.

199 serum response factor, is located within the first intron of the H2-Ealpha gene.

200 ed E-boxes (DNA recognition elements) in the first intron of the human and mouse PEDF promoter region

201 e that the intragenic CpG islands within the first intron of the human BCL6 locus were hypermethylate

202 ctor DNA-binding domain designed to bind the first intron of the human CCR5 gene.

203 G boxes located in the proximal promoter and first intron of the human KCNMB1 gene.

204 We previously demonstrated that the first intron of the human von Willebrand factor (vWF) is

205 tes in the 5' untranslated region and in the first intron of the K(v)7.4 gene were identified by bioi

206 Moreover, a p53 response element within the first intron of the KARP-1 transcriptional unit was iden

207 at the CTCF-cohesin binding site within the first intron of the latency transcript.

208 binding sites bound in vivo by GATA-3 in the first intron of the lipid acyltransferase gene AGPAT5.

209 The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activ

210 is derived from a promoter found within the first intron of the longer form.

211 roximately 200 kilobase (kb) deletion in the first intron of the MAGI1 gene was identified that segre

212 en either a 3.2-kb 5' extended region or the first intron of the mCAR gene was tested in Weri-Rb-1 ce

213 d major sites of Egr2 interaction within the first intron of the Mpz gene and approximately 5 kb upst

214 tified a highly conserved element within the first intron of the Mpz gene, which contains binding sit

215 y seven distinct regulatory areas within the first intron of the murine CD21 gene that are conserved

216 on of a regulatory region located within the first intron of the murine GATA-3 gene.

217 g one with tandem STAT5 binding sites in the first intron of the NCAM2 gene.

218 here that two adjacent enhancers inside the first intron of the neighboring (1.4 kb downstream) ATPa

219 ng identified an enhancer element within the first intron of the NUAK2 gene that can recruit SMAD pro

220 expressed from an alternate promoter in the first intron of the p21 gene.

221 response-element motifs in the promoter and first intron of the p21(WAF1/CIP1) gene that respond to

222 wed that PPR4 is associated in vivo with the first intron of the plastid rps12 pre-mRNA, a group II i

223 ts in a block containing the 5' promoter and first intron of the PTGER4 gene (encoding prostaglandin

224 ruitment to two response elements within the first intron of the PTP1B encoding gene PTPN1, correlati

225 ensus p53-binding site was identified in the first intron of the RPS27L gene and a direct binding of

226 We found that three CpG sites in the first intron of the S100A4 gene were approximately 90% m

227 -1-binding site, GCGTG was identified in the first intron of the SAG gene.

228 stimulating gene expression is the 1,028-bp first intron of the Sh1 gene that encodes maize (Zea may

229 ing the promoter, first exon and most of the first intron of the Sorcs1 gene.

230 via a novel AP-1 element located within the first intron of the sphk1 gene.

231 G-rich element from +171 to +179 within the first intron of the STAT1 gene is critical for optimal S

232 We detected STAT5A/B binding sites in the first intron of the Tfr1 gene and found that expression

233 gene flanked by lox P sites targeted to the first intron of the Th gene.

234 A SNP that maps to the first intron of the Tolloid-Like 1 gene (TLL1) showed th

235 The first intron of the trout IFN-gamma gene contains highly

236 in the promoter and in a cluster within the first intron of the VEGF gene.

237 and replication of a polymorphism within the first intron of the WISP3 gene have been shown in patien

238 Large deletions in the first intron of the With No lysine (K) 1 (WNK1) gene are

239 Deletions in the first intron of the WNK1 gene were found in a group of h

240 ding element AGGTCA separated by 4 bp in the first intron of the Xenopus ST3 gene.

241 lexes bind a DNA enhancer element within the first intron of the YAP gene to drive YAP expression in

242 We show that (CCTG) x (CAGG) repeats, in the first intron of the ZNF9 gene associated with myotonic d

243 by a (CCTG)/(CCUG)n repeat expansion in the first intron of the ZNF9 gene.

244 the association findings for two SNPs in the first intron of TLL1, rs6812849 and rs7691872, with p va

245 assays and the knockin mice, the loss of the first intron of vWF resulted in a significant reduction

246 or (A) allele of rs8060701, a variant in the first intron of ZFHX3, was associated with a 1.16-fold d

247 d with deletions in the promoter regions and first introns of A. arenosa FLCs.

248 We found that first introns of C. elegans genes, particularly those fo

249 wed that defined non-coding regions, such as first introns of genes and regulatory domains, are assoc

250 presence of MSR1 repeats in the promoters or first introns of genes is associated with greater popula

251 is almost identical to the ones found in the first introns of other three TRAIL receptor genes.

252 d in transcription termination events within first introns of pc genes.

253 nds preferentially to certain E-boxes within first introns of specific gene isoforms.

254 Y) is strongly enriched in the promoters and first introns of VAL-repressed genes, including the earl

255 g one or more G4 motifs at the 5'-end of the first intron, on the non-template DNA strand.

256 cus in the absence or presence of the native first intron or heterologous introns from the human beta

257 G >T) located in the 5' upstream regulatory, first intron or promoter regions.

258 ing a region upstream of PTEN and the gene's first intron (P=.0027).

259 In addition, elements in the first intron participate in the T3 induction of CPT-Ialp

260 meres and are enriched in gene promoters and first introns, raising the possibility that perturbation

261 The promoter and first intron regions of the human Hsp27 gene were cloned

262 gene fusions to identify features of the Sh1 first intron required for enhancement in cultured maize

263 y that the 9.0 kb upstream sequences and the first intron residing in the 5' untranslated area are cr

264 ic sequences revealed three introns with the first intron residing within the 5'-untranslated region.

265 ons just after the stop codon and within the first intron, respectively.

266 ew exon (exon 1.2) was identified within the first 'intron' resulting in novel splice variants in TM3

267 Also, lacZ driven by the same promoter/first intron revealed beta-galactosidase expression in h

268 intronic and primarily localized within the first intron, revealing this position as a common featur

269 The small DNA fragment contains the first intron sequence located downstream of the first ex

270 4 are intron-free, while Cell-2 contains the first intron sequence to be identified from a termite sy

271 binding of GATA-4 and IRF-1 and IRF-2 to the first intron sequence.

272 individual cis-acting elements, such as the first intron sequence.

273 sted the potential of the highly polymorphic first intron sequences from members of the plant beta-tu

274 d a significant positive correlation between first intron size and the number of TF interactions obta

275 can Americans (P = 0.004), but haplotypes of first intron SNPs -4,521 to -657 did not (P > 0.2).

276 ription of SAMD4A, a gene with a 134 kb-long first intron, splicing joins the 3' end of exon 1 to suc

277 tion of the selection gene cassette into the first intron suppressed the corrected allele transcripti

278 (VWF) gene between -2812 and the end of the first intron (termed vWF2) was previously shown to direc

279 ct an Egr2-responsive element within the Mpz first intron that also contains binding sites for the tr

280 ll receptor-responsive enhancer in the FoxP3 first intron that is dependent on a cyclic-AMP response

281 he HDMX gene contains a promoter (P2) in its first intron that is potentially inducible by p53.

282 ion that extends over 35 kb and includes the first intron, the first two exons and the transcription

283 transcripts included the beta-globin gene's first intron, the PRE, PPE and CJE still enhanced mRNA b

284 sequences of three E-box sites within PHM's first intron; the sites make different contributions to

285 c-Myc could bind to a conserved site in the first intron to activate the promoter.

286 A within the MIE gene at the position of the first intron to affect RNA polymerase II function during

287 d either the VGLUT1 upstream promoter or the first intron to this basal promoter.

288 ent splicing of the B19V pre-mRNA within the first intron (upstream of the (pA)p site) stimulated the

289 Z transgene construct from -2600 through the first intron was expressed in myofibroblasts within gran

290 rat aggrecan gene (83 kb including the 30-kb first intron) was surveyed for active elements, which wo

291 from the CD68 gene, in addition to the CD68 first intron, was able to direct macrophage-specific exp

292 13 kilobases of the mouse CSF-1 promoter and first intron were characterized.

293 ion start site, and a CpG-rich region in the first intron were hypermethylated in HCC cells.

294 6-kb DNA fragment including the promoter and first intron, were also induced.

295 to bind to P5CS1 regulatory sequences in the first intron, which carries a conserved PHR1-binding sit

296 An "eye enhancer" was localized to the first intron, which controls specific expression in the

297 tragenically located and includes the 558-bp first intron, which is responsible for high-level expres

298 th transcript contributes to assembly of the first intron, which is thus tripartite.

299 d Nodal response element (NRE) in the squint first intron, while expression in the extra-embryonic en

300 We show that the first introns within most genes play a particularly impo