ライフサイエンスコーパス: inverted repeat

1 bacterial recombination site that is not an inverted repeat.

2 rgeted sequences resembling the Ty3 terminal inverted repeat.

3 r the HetR protein so far, a seven-base pair inverted repeat.

4 onucleotide corresponding to the Mu terminal inverted repeat.

5 ing transcription factor binding sites or an inverted repeat.

6 rangement, including large expansions of the inverted repeat.

7 upstream of tbpA and separated from it by an inverted repeat.

8 ymmetry centred on a conserved 5'-TAC/GTA-3' inverted repeat.

9 e polintovirus PolB gene along with terminal inverted repeats.

10 namely sites of convergent transcription and inverted repeats.

11 multiple genes that contain poorly conserved inverted repeats.

12 y in regions that contain numerous tandem or inverted repeats.

13 as does a pair of synthetically constructed inverted repeats.

14 le the HTH domain canonically recognizes two inverted repeats.

15 repeats and is demarcated by 8-bp imperfect inverted repeats.

16 ends to underestimate the expected number of inverted repeats.

17 ter families, many of which contain internal inverted repeats.

18 n transposon target sites and their terminal inverted repeats.

19 tation, can generate a substantial excess of inverted repeats.

20 gments and genes interspersed with noncoding inverted repeats.

21 erated by flanking a DNA sequence with short inverted repeats.

22 ate short inversions, some flanked by paired inverted repeats.

23 L) and a unique short region (US) flanked by inverted repeats.

24 An inverted repeat 0 (IR-0) FXR response element, acting as

25 repertoire of sites with DR0, DR8, and IR0 (inverted repeat 0) elements.

26 ostly in intergenic and intron regions at an inverted repeat 1 motif in both groups, but also cluster

27 d repeat spaced by one nucleotide DNA motif, inverted repeat-1 (5'-AGGTCAcAGACCT-3'), as a likely FXR

28 ium coupled cotransporters of the five-helix inverted repeat (5HIR) superfamily use an alternating ac

29 nd subterminal repeats of the Muta1 terminal inverted repeat also influence Muta1 transposition.

30 ound that it has a single exon that includes inverted repeat Alu elements (IRAlus).

31 In many cells, mRNAs containing inverted repeated Alu elements (IRAlus) in their 3' untr

32 In many cells, mRNAs containing inverted repeats (Alu repeats in humans) in their 3' unt

33 Rather, they are flanked by nearly identical inverted repeats and enclosed within direct repeats, sug

34 nontransposon sequences have longer terminal inverted repeats and higher GC content in terminal and s

35 o demonstrate a novel method for identifying inverted repeats and inversion variants, both of which c

36 only the oligo(T) trail sequence and not the inverted-repeat and loop region.

37 aining segment, five 9-bp direct repeats, an inverted repeat, and a sigma(A)-dependent promoter for t

38 at involves both homology-driven events, via inverted repeats, and microhomologous or nonhomologous e

39 In addition, the boundaries of inverted repeats are hot spots for gene duplications or

40 duces precise nicks in the degenerate, short inverted repeats at the ends of linear viral DNA.

41 AccR-P binds in vitro to a conserved inverted repeat (ATGCA-N6-TGCAT) present at two differen

42 n an uncharacterized protein that we termed "Inverted Repeat Binding Protein (IRBP) 18" and its partn

43 ing of tandem copies of the ethanol receptor inverted repeat binding site, in combination with a mini

44 ls, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple

45 The edited cytidines are often flanked by inverted repeats, but are largely distinct from those de

46 ation that closed-circular DNA containing an inverted repeat can release the free energy stored in ne

47 Thus inverted repeats can act as an important force in evolut

48 its inherent instability in genomic DNA, the inverted repeat catalyzes spontaneous self-excision, res

49 s present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for

50 consist entirely of imperfect 69-bp terminal inverted repeats characteristic of the Foldback class of

51 terminal three nucleotides of the P-element inverted repeats complement and restore the original TSM

52 our of the breakpoint regions included large inverted repeats composed of repetitive gene clusters an

53 ysis across the genome found that the large, inverted repeats comprise a recombination hot spot.

54 transgenic loci have two T-DNA copies in an inverted repeat configuration, centered at the right bor

55 sis of closely linked transposon ends in the inverted-repeat configuration and therefore suppresses t

56 l density analysis determined that the large inverted repeats constitute a recombination hot spot.

57 We inserted an inverted repeat containing a fluorophore-quencher pair i

58 An inverted repeat-containing sequence in the hepA promoter

59 terial chromosome that consists of a pair of inverted repeat core sites called B and B' in attB.

60 rocess where one copy of a small, imperfect, inverted repeat corrects the other copy via strand misal

61 he absence in M. truncatula of the prominent inverted repeat cpDNA sequence found in most plant speci

62 the target gene and sequence features of the inverted repeat did not reveal any factors capable of pr

63 Transporters from bacteria to humans contain inverted repeat domains thought to arise evolutionarily

64 However, expression of an inverted-repeat double-stranded RNA corresponding to the

65 Here, we show that small (5-9 bp) inverted repeats drive the formation of large palindromi

66 is initiated by restricted expression of an inverted-repeat dsRNA specifically in the Arabidopsis (A

67 ed His-tagged RpaR (His(6)-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the

68 n and that of downstream genes by binding an inverted repeat element in its upstream region.

69 Two in silico-identified inverted repeat elements were not involved in the respon

70 GRF is more sensitive than Inverted Repeat Finder in TIR detection, LTR_FINDER in s

71 Upstream of cwpV, inverted repeats flank a 195 bp sequence which undergoes

72 re posit that backsplicing is facilitated by inverted repeats flanking the circularized exon(s).

73 ermination signal in DNA consists of a short inverted repeat followed by a T-rich stretch.

74 e 7-1-7 repeat element, Zur requires a 9-1-9 inverted repeat for high-affinity binding.

75 anism by which RNAs transcribed from the CHS inverted repeat form aberrant double-stranded RNAs that

76 a precursor in which an imperfectly matched inverted repeat forms a partly double-stranded region.

77 gestive of an evolutionary antecedent of the inverted repeats found within the subunits of many membr

78 most likely are ancient remnants of terminal inverted repeats from a long-lost TE.

79 sion of GCRs in other studies, we found that inverted repeat fusion has a profile of genetic regulati

80 Here we analyzed inverted repeat fusion in mutants of three sets of genes

81 This inverted repeat fusion reaction forms dicentric chromoso

82 e find that two checkpoint pathways suppress inverted repeat fusion, and that their activities are di

83 nd Dun1 act independently of Exo1 to prevent inverted repeat fusion.

84 or disrupted DNA replication forks can cause inverted repeat fusion.

85 , activity of Rad53 is sufficient to prevent inverted repeat fusion.

86 alensis and described proliferation of small inverted repeats (hairpins) that occurred in it since th

87 hybrid nixA-ureA promoters demonstrated that inverted repeat half-sites, spacers, and flanking DNA ar

88 The upstream region of orf2c contained two inverted-repeat half sites.

89 ing of these cavities is synchronized by the inverted repeat helices 3 and 8, providing the structura

90 s, Candida tropicalis, possesses homogenized inverted repeat (HIR)-associated centromeres.

91 ss the ainS-ainR junction, including a large inverted repeat in ainR.

92 We found that this inverted repeat in cis can affect accumulation of the Ai

93 h operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front

94 leads to nicking of ICEBs1 between a GC-rich inverted repeat in oriT, and NicK was the only ICEBs1 ge

95 vated by BmaR1 and octanoyl-HSL, and a 20-bp inverted repeat in the bmaI1 promoter is required for bm

96 more, in human Colo320DM cancer cells, a DNA inverted repeat in the genome marks the border between a

97 e report here that a specific pair of nearby inverted repeats in budding yeast fuse to form a dicentr

98 hown that there is a large excess of perfect inverted repeats in many prokaryotic genomes but not in

99 for setting deletion boundaries by flanking inverted repeats in Tetrahymena thermophila.

100 mation of large DNA palindromes and that DNA inverted repeats in the genome determine the efficiency

101 regulated process that is facilitated by DNA inverted repeats in the genome.

102 eaks (DSBs) introduced a large distance from inverted repeats in the yeast (Saccharomyces cerevisiae)

103 By removing and testing two such inverted repeats in vivo, we found that the ability for

104 We propose a model called short-inverted repeat-induced synthesis in which DNA synthesis

105 However, like RDR6, SDE5 is not involved in inverted repeat-induced transgene silencing or the bioge

106 guided by the leader sequence and a pair of inverted repeats inside the CRISPR repeat.

107 In fission yeast, the inverted repeats IR-L and IR-R function as boundary elem

108 For species with minor inverted repeat (IR) boundary changes in the plastid gen

109 wn to be several times slower in the plastid inverted repeat (IR) compared with single-copy (SC) regi

110 Here, we show that a TE-derived inverted repeat (IR) element, inserted near the sunflowe

111 wo genes (clpP, rpoC1), and expansion of the inverted repeat (IR) into both large and small single-co

112 A specific RhpR-binding site containing the inverted repeat (IR) motif GTATC-N6-GATAC, was mapped to

113 The total genome size is 162,321 bp, with an inverted repeat (IR) of 27,273 bp, large single-copy (LS

114 The inverted repeat (IR) sequences delimiting the left and r

115 form extrusion at both perfect and imperfect inverted repeat (IR) sequences.

116 The genome has a markedly higher inverted repeat (IR) size of 37.4 kb, suggesting large-s

117 s motif overlaps with a previously described inverted repeat (IR) that is crucial for cap expression.

118 a long noncoding RNA (lncRNA) containing an inverted repeat (IR) with >80% identity to W1-COE The Iw

119 gumes, which also lost one copy of the large inverted repeat (IR).

120 RNA interference suppression of this gene in inverted-repeat (ir)JAZh plants deregulated a specific b

121 DNA inverted repeats (IRs) are hotspots of genomic instabili

122 eletion mutants, we found that the number of inverted repeats (IRs) flanking the promoter is variable

123 enetic instability at palindromes and spaced inverted repeats (IRs) leads to chromosome rearrangement

124 ,528 bp in length, composed with one pair of inverted repeats (IRs) of 26,819 bp, which were separate

125 rsions ranging from 3.1 to 742 kb flanked by inverted repeats (IRs) up to 134 kb long.

126 Palindromic sequences, or inverted repeats (IRs), in DNA sequences involve importa

127 One isoform that contains the inverted repeat is retained in the nucleus, whereas anot

128 s suggests that the reported large excess of inverted repeats is due to repeats found in intergenic r

129 We next show that fusion of nearby inverted repeats is general; we found that many nearby i

130 n many chloroplast genomes, the inference of inverted repeats is needed in chloroplast phylogeny anal

131 ncatula is a legume species belonging to the inverted repeat lacking clade (IRLC) with trifoliolate c

132 In Inverted Repeat-Lacking Clade (IRLC) legumes such as Med

133 Within nodules of inverted repeat-lacking clade (IRLC) legumes, rhizobia d

134 In rhizobial species that nodulate inverted repeat-lacking clade (IRLC) legumes, such as th

135 In the Inverted Repeat-Lacking Clade (IRLC) of legumes, this di

136 er, in a large subclade of the Fabaceae, the inverted repeat-lacking clade (IRLC), of which pea is a

137 Here, we show that an inverted repeat located between positions -1144 and -113

138 nce analysis, we have now identified a 77-bp inverted repeat located upstream (206 bp) of the start c

139 BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis

140 Inverted repeats located as far as 21 kb from each other

141 nding sites reveals that the tetranucleotide inverted repeats long believed to be important for C-pro

142 They have only been observed in the inverted repeat loss clade (IRLC) of legumes, which incl

143 Phaseoleae, two in Dalbergieae, two in the 'inverted repeat loss' clade, and one in the Robinieae, w

144 Large palindromes (inverted repeats) make up substantial proportions of mam

145 A similar inverted repeat-mediated mechanism may underlie structur

146 ing Z-DNA motifs, quadruplex-forming motifs, inverted repeats, mirror repeats and direct repeats and

147 faster and more sensitive than the existing inverted repeat/MITE detection tools based on numerical

148 co-transport proteins that use a five-helix inverted repeat motif have recently emerged as one of th

149 ps each characterized by a distinct terminal inverted repeat motif.

150 Terminal inverted repeat MULEs are the predominant MULE type and

151 ions in the binding sites that conserved the inverted repeat nature of the sites.

152 nsable for GC-induced evolutionary conserved inverted repeated negative GC response element (IR nGRE)

153 lusive for GC-induced evolutionary conserved inverted repeated negative GC response element (IR nGRE)

154 s not large and cannot explain the excess of inverted repeats observed in real data.

155 In at least one haplotype, inverted repeats occur more frequently than elsewhere in

156 roplast DNA is 159,370 bp in size and has an inverted repeat of 21,665 bp.

157 afQ-(DinJ)2-YafQ or a DinJ dimer at a single inverted repeat of its recognition sequence that overlap

158 the central axis of the channel, without the inverted repeat of mammalian-type urea transporters.

159 nation, a mutagenesis cassette containing an inverted repeat of selection marker(s) is integrated int

160 presence of the known CmeR-binding site, an inverted repeat of TGTAAT, in the promoter region of Cj0

161 rder of the small single copy region and the inverted repeat of the chloroplast genome.

162 ter, which is composed of a highly conserved inverted repeat of the core Mkx recognition motif.

163 cp genome size is 151,173 bp with a pair of inverted repeats of 27,093 bp separated by small and lar

164 facing conformation with a core structure of inverted repeats of 5 TM helices (TM2 to TM6 and TM7 to

165 retention of mRNA containing in their 3'-UTR inverted repeats of Alu sequences (IRAlu).

166 ane helices, 10 of which are arranged in two inverted repeats of five helices.

167 inear elements, at least one of the terminal inverted repeats of pBSSB1 is non-essential, but that a

168 lasts and some bacteria, in that it contains inverted repeats of ribosomal RNA operons.

169 es and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known

170 nt cassettes, the presence of nearly perfect inverted repeats of ~100 bp near the 5' end of vlsE, and

171 s been reported for ectopic HR events (e.g., inverted repeats or between plasmids), Rad51 has been th

172 enic lines containing short gene segments in inverted repeat orientation designed to reduce expressio

173 ntly formed by intrachromosomal NAHR between inverted repeat pairs comprising one amplicon on Yp and

174 promoter through mutational analysis of the inverted repeat present within the promoter.

175 ist of antiparallel dimers that resemble the inverted repeats present in larger transporters.

176 revealed the presence of AT-rich direct and inverted repeats previously reported to function as DegU

177 An inverted repeat pseudogene can also generate abundant sm

178 ce or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences.

179 The hsdS sequences flanked by inverted repeats (referred to as epigenetic invertons) i

180 The inverted repeats refold to generate Holliday junctions,

181 Both species also had a large inverted repeat region (LIR) of approximately 12 kb, the

182 s that enable insertion of transgenes in the inverted repeat region of the plastome between the trnV

183 w that these two genes, as well as the 77-bp inverted repeat region, are cotranscribed with the capsu

184 Partly because of independent losses of one inverted repeat region, Orobanchaceae plastomes vary 3.5

185 ease-sensitive region that overlaps with the inverted-repeat region of the UEE.

186 lation levels in the internal and terminated inverted repeat regions of these elements, which might b

187 e sequence, termed Heltir, that has terminal inverted repeats resembling Helitron 3' termini.

188 DSB initiates a pairing interaction between inverted repeats, resulting in the formation of large di

189 pulated genetically to express gene-specific inverted-repeat RNA sequences exhibited significant redu

190 , non-canonical promoters consisting of 9 bp inverted repeats separated from a -10 hexamer by 19 bp.

191 of interest: an RNA/DNA hybrid domain and an inverted repeat sequence capable of forming a stem-loop

192 Ser beta-sheet that binds specifically to an inverted repeat sequence distinct from those recognized

193 sin occurred via binding directly to a short inverted repeat sequence in the intergenic region overla

194 v3066 regulator binds to a 14-bp palindromic inverted repeat sequence in the nanomolar range.

195 otein in various genetic backgrounds, and an inverted repeat sequence in the promoter of hetP was nec

196 inal domain of AcrIIA13-AcrIIA15 binds to an inverted repeat sequence in the promoter of these Acr ge

197 R binds specifically and tightly to an 11-bp inverted repeat sequence in the promoter regions of the

198 tprinting demonstrated binding of CouR to an inverted repeat sequence that overlaps the -10 region of

199 sses a single operon by binding to a perfect inverted repeat sequence, whereas HpNikR binds to promot

200 Disruption of an inverted-repeat sequence eliminated DNA secretion, sugge

201 An inverted-repeat sequence located upstream of trpE bound

202 owed in Saccharomyces cerevisiae that nearby inverted repeat sequences ( approximately 20-200 bp of h

203 ments are flanked by characteristic terminal inverted repeat sequences (TIRs).

204 n integrate both short oligonucleotides with inverted repeat sequences and a 2.8 kb excised mini-casp

205 taining many copies of the viral genome with inverted repeat sequences at the junctions between monom

206 " class of mutations that arise in imperfect inverted repeat sequences by DNA-strand misalignments du

207 Two inverted repeat sequences that represent potential bindi

208 posase binds specifically to ISY100 terminal inverted repeat sequences via an N-terminal DNA-binding

209 at are repaired using multiple distinct long inverted repeat sequences.

210 ons that self-assemble from single identical inverted-repeat sequences.

211 unique long (UL) region and a segment of the inverted repeat short (IRS)/unique short (US) region.

212 While some Phantom elements have terminal inverted repeats similar in length and structure to Muta

213 Selected repetitive sequences termed short inverted repeats (SIRs) have the propensity to form seco

214 econdary structure consisting of subterminal inverted repeats (SIRs).

215 man miR-29a promoter identified an imperfect inverted repeat spaced by one nucleotide DNA motif, inve

216 of Manduca sexta grew faster when consuming inverted-repeat stable transformants (irAGO8) plants but

217 Its 5' and 3' terminal inverted repeats start with conserved CACTA sequence.

218 The functional relevance of the inverted repeat structure (IR/DR) in a subgroup of the T

219 None of the rearranged sequences showed the inverted repeat structure characteristic of BFB; instead

220 sporters (SLC26Dg and UraA), to have a 7 + 7 inverted repeat structure with anion transport initiated

221 functional relevance of the pseudosymmetric inverted-repeat structures of the antiporter-like subuni

222 o Mutator elements, some display subterminal inverted repeats (sub-TIRs) and others have more complex

223 short ( approximately 30- to 40-nucleotide) inverted repeats, such as Alu elements, are sufficient t

224 nt Repeat Database and searches for flanking inverted repeats suggest that the high incidence of disp

225 amily and a member of the widespread 5-helix inverted repeat superfamily of transporters.

226 Finally, we show that fusion of inverted repeats, surprisingly, does not require genes i

227 Purified YqjI binds inverted repeat target sequences within the yqjH and yqj

228 forms a tetramer, which tightly binds to an inverted-repeat target sequence overlapping with the pro

229 matin at centromeres I and III is flanked by inverted repeats termed IRCs, which are required for pro

230 Defined by a conserved 5-helix inverted repeat that encodes common principles of ion an

231 s of the complete regulon identified a 15 bp inverted repeat that functions as a high-affinity bindin

232 Instead P(m) has a hyphenated inverted repeat that serves as the Mor binding site over

233 entifies a previously unknown pair of 5' UTR inverted repeats that act by altering the relative fimA

234 several homonucleotide runs as well as small inverted repeats that are able to form strong secondary

235 epeats is general; we found that many nearby inverted repeats that are present in the yeast genome al

236 Fusion occurs between inverted repeats that are separated by several kilobases

237 e DUP-TRP/INV-DUP structures are mediated by inverted repeats that can be separated by >300 kb, a gen

238 ast, the smaller, but significant, excess of inverted repeats that we report in protein coding sequen

239 ztransib has 3518 bp including a 5' terminal inverted repeat (TIR) of 552 bp, a promoter sequence of

240 TEs) are short DNA transposons with terminal inverted repeat (TIR) signals and have been extensively

241 he transposase activities including terminal inverted repeat (TIR) specific DNA-binding activity, DNA

242 inal repeat (LTR) retrotransposons, terminal inverted repeat (TIR) transposons, short TIR transposons

243 ransposase activities, including 5'-terminal inverted repeat (TIR)-specific binding and assembly of a

244 the transposase domain possesses 5'-terminal inverted repeat (TIR)-specific DNA binding, DNA looping,

245 ucleotide duplexes derived from the terminal inverted repeats (TIR) of the A. boonei casposon as well

246 The P-element 31-bp terminal inverted repeats (TIRs) contain sequences essential for

247 get site duplications and a pair of terminal inverted repeats (TIRs) resembling V(D)J recombination s

248 tion bias toward noncoding regions, terminal inverted repeats (TIRs), target site duplications, and p

249 GRF sensitively identifies terminal inverted repeats (TIRs), terminal direct repeats (TDRs),

250 superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback

251 t core of 10 TMSs is made of two intertwined inverted repeats (TMS1-5 and TMS6-10) that are followed

252 can also be shortened from the native 50-bp inverted repeat to 26 bp; thus, the Agrobacterium hairpi

253 ate faulty template switching between nearby inverted repeats to form dicentric chromosomes.

254 Fusion of nearby inverted repeats to form dicentrics may be a major cause

255 lineate two pathways that spontaneously fuse inverted repeats to generate unstable chromosomal rearra

256 ow that this T-DNA configuration produces an inverted repeat transcript and that small interfering RN

257 ardtii, sRNAs derived from genome-integrated inverted repeat transgenes, perfectly complementary to t

258 The insertion is a miniature inverted repeat transposable element (MITE) that contain

259 An active miniature inverted repeat transposable element (MITE), mPing, was

260 flanking a transposable element (a miniature inverted repeat transposable element) insertion in the S

261 Miniature inverted repeat transposable elements (MITEs) are preval

262 Miniature inverted repeat transposable elements (MITEs) are preval

263 Miniature inverted repeat transposable elements (MITEs) are widesp

264 arities to archaeon and eukaryotic miniature inverted repeat transposable elements.

265 217 insertions of 18 Stowaway-like miniature inverted-repeat transposable element (MITE) families pre

266 onia solani and found that Tourist-miniature inverted-repeat transposable element (MITE)-derived smal

267 We found a miniature inverted-repeat transposable element insertion in the pr

268 Miniature inverted-repeat transposable elements (MITEs) are a spec

269 Although miniature inverted-repeat transposable elements (MITEs) are closel

270 Miniature inverted-repeat transposable elements (MITEs) are short

271 Miniature inverted-repeat transposable elements (MITEs) constitute

272 share all the classic features of miniature inverted-repeat transposable elements (MITEs), including

273 sons and retrotransposons, such as miniature inverted-repeat transposable elements (MITEs), long term

274 riched with the Stowaway family of miniature inverted-repeat transposable elements (MITEs).

275 genome has features in common with miniature inverted-repeat transposable elements (MITEs): high A +

276 Among TEs, miniature inverted-repeat transposable elements are nonautonomous

277 (PEGs), which were associated with miniature inverted-repeat transposable elements, imprinted differe

278 ified ISs, and of hitherto unknown miniature inverted-repeat transposable elements.

279 r molecules centred at kinked helices in two inverted-repeat triple-helix bundles (THBs).

280 high propensity to execute a U-turn at small inverted repeats (up to 1 in 40 replication events).

281 perates as a conserved rheostat between long inverted repeats upstream of each exon.

282 gions; identified the ISs' possible terminal inverted repeats, usually flanked by direct repeats; and

283 Uniquely, the canonical inverted repeat was converted into a direct repeat (DR)

284 A DNA motif consisting of an inverted repeat was identified in each of the promoters

285 Breakpoints occurring in the terminal inverted repeats were excluded from analysis to prevent

286 The oriT2 site contains a large inverted repeat (where the nic site is located) adjacent

287 t DNA is 160,149 bp in size with a 21,822-bp inverted repeat, whereas NIES293 (West Pacific) chloropl

288 acterium liquefaciens comprises a five-helix inverted repeat, which is widespread among secondary tra

289 ment and a 73-bp sequence were identified as inverted repeats, which could explain the possible mecha

290 ding sequences they both detect an excess of inverted repeats, which is much lower than previously re

291 ation repair (PRR) pathway prevent fusion of inverted repeats, while genes in the translesion branch

292 two copies of an 11 bp motif arranged as an inverted repeat with 1 bp spacing.

293 tor sites having more than one 5'-TAC/GTA-3' inverted repeat with implications in vivo for a mechanis

294 ally high GC content, each containing a long inverted repeat with one or two protein-coding genes and

295 They are arranged as a pair of inverted repeats with a 2-bp overlap between the repeats

296 ement in chloroplasts is probably limited by inverted repeats with a conserved core region.

297 footprint data in E. coli generally contains inverted repeats with significantly (p < 0.05) greater p

298 These flanking sequences are inverted repeats with the copies located at nearly ident

299 uble-stranded DNA binding activities for the inverted repeat within either oriT sequence.

300 specific, imperfect DNA hairpin formed by an inverted repeat within the upstream essential element (U