ライフサイエンスコーパス: measurably

1 l treatment of gaps, ET performance improves measurably.

2 rations of carbachol to increase [Ca(2+)](i) measurably.

3 bind with low affinity, and two do not bind measurably.

4 cted in particles and therefore did not bind measurably.

5 Preterm birth did not measurably accelerate the maturation of the IgA repertoi

6 The Kdm4 proteins did not measurably accumulate at gamma-irradiation-induced gamma

7 f the cue on attention in task 1; it was not measurably active in task 2.

8 old weaker and even 3''-dephospho-AdA (5) is measurably active, despite missing one of the vicinal bi

9 ast, the cholinergic agent donepezil did not measurably affect arousal or the curve.

10 erality of an irradiated breast cancer could measurably affect cardiac mortality and mortality from c

11 of endogenous SA in transgenic rice does not measurably affect defense gene expression, but reduces t

12 ion of the amyloid dye thioflavin T does not measurably affect fibril stability, in contrast to the c

13 though exposure to these statements does not measurably affect general support for political violence

14 impair DNA binding of GATA1 in vitro did not measurably affect in vivo target gene occupancy.

15 It is less understood how these experiences measurably affect individuals' lifelong health and well-

16 The presence of K2 did not measurably affect liposome surface accessibility or lipi

17 concentrations well below those required to measurably affect Met expression or cell proliferation.

18 These results show that base-pairing can measurably affect nonradiative decay pathways in A.T dup

19 g (i.e., inescapable and unpredictable), can measurably affect subsequent neuronal properties and cog

20 st that spatial and temporal variance do not measurably affect the analysis.

21 A photodegradation processes could therefore measurably affect the budgets of both particulate and ga

22 While deletion of the N-terminus does not measurably affect the global structure of the complex, t

23 electrochemical treatment did not appear to measurably affect the noise, longevity, metal adhesion,

24 onfirmed that stimulation with light did not measurably affect the rate of conversion of [3H]histidin

25 MMOR, and the oxidized hydroxylase does not measurably affect the structure of the diiron(III) site.

26 ating, however, NCS-1 co-expression does not measurably affect the voltage dependence of steady-state

27 stabilize proteins in bulk solution, do not measurably affect their stability when they are attached

28 ect lay between 0.1 and 1 microM and was not measurably affected by cytosolic acidification.

29 t-1 TG mice, and tumor growth rates were not measurably affected by late ovariectomy.

30 ersity of the gastrointestinal microbiota is measurably affected by perinatal H pylori exposure.

31 HBV transcription was not measurably affected by the absence of the HNF1 alpha tra

32 iting planets, the times of the transits are measurably affected by the gravitational interactions be

33 GTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity.

34 lthough Kv4.3 mRNA/protein expression is not measurably affected, KChIP2 expression is markedly reduc

35 iagnosis and/or treatment of the patient was measurably affected.

36 e-, urea-, and acid-induced denaturation was measurably affected.

37 s and evoked action potential firing without measurably affecting the expression or localization of v

38 TP and long-term spatial memory, yet neither measurably affects basal synaptic transmission.

39 y reduced curvature, and the removal of Mg2+ measurably affects bending.

40 relatively low levels of HIV-1 that did not measurably alter host gene transcriptome.

41 inhibition of the Na+-Ca2+ exchanger did not measurably alter the amplitude or decay kinetics of the

42 ering the P450 17A1 conformation but did not measurably alter the binding of 17alpha-OH pregnenolone

43 5-Fluoro substitution does not measurably alter the excitation-induced change in perman

44 s found that vesicular release events do not measurably alter the impedance, but the depolarizing sol

45 S1 antigenemia indicated balapiravir did not measurably alter the kinetics of these virological marke

46 find that ATP depletion in the cell does not measurably alter the parameter, and we thus conclude tha

47 rements show that some of these Gly residues measurably alter the rates of metal ion association and

48 ependently of the CD28/B7 system and was not measurably altered by CD28.

49 ility and activity of many glycovariants was measurably altered by N-linked glycans in a manner that

50 v4.3, Kv1.4, Kv2.1, Kv2.2), however, are not measurably altered in Kv4.2-/- cortices.

51 ary structure of the inactive complex is not measurably altered.

52 lower, but ileal mucosal blood flow was not measurably altered; c) lipopolysaccharide-evoked tumor n

53 peractivity of joint sensory neurons without measurably altering joint inflammation.

54 the aspartate 84 (D-84) mutants studied bind measurably, although they are efficiently incorporated i

55 erence to these protocols is associated with measurably beneficial effects on the psychological healt

56 l-managed protected and conserved areas that measurably benefit populations.

57 r infections, pulmonary vaccination provides measurably better protection against pulmonary challenge

58 f life in patients who underwent surgery was measurably better than that of the medical cohort with u

59 While the N-terminal lobe alone does not measurably bind cellular transferrin receptors or serve

60 ne (CQ) with a K(D) near 400 nM but does not measurably bind the related drug quinine (QN) at physiol

61 Isoflurane gas measurably blunted the response to apomorphine, so that

62 iants had low V3 sequence diversity and were measurably bound by these nAbs.

63 mposition of terrestrial sulfate is affected measurably by many Earth-surface processes.

64 ed the affinity for the receptor but did not measurably change peptide selectivity.

65 A study on an antireflux stent will not measurably change the current use of this device, but em

66 ed cleavage of the nascent RNA, but does not measurably change the rates of single nucleotide additio

67 CD1a, CD 69, CD 80 and CXCR3 did not measurably change.

68 utoinducer-2 [AI-2]) and responds to AI-2 by measurably changing production of several infection-asso

69 tion of the current through the wild type is measurably conducted through R352Q.

70 te ion, 86% of the added peroxynitrite being measurably converted to this species.

71 Ca(2+) influx for mitochondria to influence measurably cytosolic [Ca(2+)] signals under physiologica

72 ur results show that, globally, river ice is measurably declining and will continue to decline linear

73 enza vaccination, highlighting that vaccines measurably decrease illness and associated healthcare ut

74 Four of the proteins identified as measurably decreased and validated by immunoblot analysi

75 tly with any single factor, though they were measurably decreased by hydrogen bonding to an E7 glutam

76 risingly, the mutated Imp4 proteins were not measurably defective for interaction with Mpp10p in the

77 cl-2 or bcl-XL transgenes did not prevent or measurably delay photoreceptor degeneration.

78 rocks from Earth and the moon does not vary measurably (delta(56)Fe = 0.0 +/- 0.3 per mil).

79 ed by deprotonation in the 2-position is not measurably deprotonated at equilibrium because the ion i

80 ive forms of eight of the nine variants were measurably destabilized, by 1-7 kcal/mol (1 cal=4.184 J)

81 ndergoes a conformational change, it assumes measurably different conformations.

82 C15) showed disruption of each pathway with measurably different efficiencies and reaction rates.

83 monolayer-protected clusters (MPCs) occur at measurably different electrochemical potentials owing to

84 Atherosclerosis in germ-free animals was not measurably different from that in animals raised with am

85 cteristics of the truncated variant were not measurably different from those of full-length HjLPMO9A,

86 a physical system can simultaneously include measurably different physical states.

87 single donor, exhibit channel activity with measurably different voltage-dependent gating, a finding

88 k-1 of the rUreR-DNA complex interaction was measurably different when urea was present.

89 risk groups in which clinical outcomes were measurably different.

90 Prazosin did not measurably displace [3H]CUMI-101 binding in baboon or hu

91 We observe measurably distinct phylogenetic profiles among proteins

92 inding indicate that the pro region does not measurably distort the protease active site.

93 The cue still measurably drew exogenous attention to itself, yet witho

94 The cue measurably drew exogenous attention to itself.

95 anticodon and extra arm of tRNALeu-1 do not measurably effect its ability to serve as a substrate fo

96 is, senescent dog RBCs were found to contain measurably elevated membrane-bound (denatured) globin an

97 firm clearly that subgingival microbiota are measurably elevated several years prior to progression o

98 Acylation did not measurably enhance raft association by the first two ass

99 (2 mug/mL (ppm) to 5 mug/mL) in the solution measurably enhance the catalytic activity of the OER, li

100 two novel genes (Tcr_0466 and Tcr_2018) was measurably enhanced.

101 greatly improved amyloid nucleation without measurably enhancing beta-structure in the monomer ensem

102 ized: while lineages in the blood are rarely measurably evolving following influenza vaccination, lin

103 ineages containing GC B cells are frequently measurably evolving.

104 SpeB was not measurably expressed in strains containing covR(WT)/covS

105 cs of humans and agents we collected deviate measurably from each other.

106 that mobile-phone use during illness differs measurably from routine behavior: Diagnosed individuals

107 mations of the transformed variants differed measurably from transformed plasma alpha2M.

108 s preferred, perceived as unsafe and cause a measurably greater stress response.

109 endosomes and then into the cytosol, without measurably harming the cells.

110 rmed early and the home learning environment measurably helps shape the lexicon from the outset.

111 preading events, in which an individual with measurably high connectivity is responsible for infectin

112 We find that temporal resolution is measurably higher for each feature than for their conjun

113 Mortality elevation was measurably higher for less deadly cancers (breast, color

114 The affinity is measurably higher for RanGDP than for RanGTP and varies

115 gun control, whereas individuals displaying measurably higher physiological reactions to those same

116 peroxide production by wild-type FNR-Fld was measurably higher than that generated by FNR-D144A or FN

117 Within the approximately 300-nm region measurably illuminated by the evanescent field resulting

118 This alteration may measurably impact human behavior.

119 ther required for the induction of Tregs nor measurably impact on the extent of their accumulation.

120 Notably, ITPK1 deficiency did not measurably impact survival of IgA-opsonized target cells

121 Furthermore, we show that the link does not measurably impact the phase coherence of the qubit.

122 rium numbers, lower doses (e.g., <=0.6 mg/L) measurably impacted the broader microbial community, ind

123 and diminishing established disease without measurably impacting general immunocompetence.

124 h could alter the charge of lysines, did not measurably impair DNA translocation or affect the one-wa

125 an increase in O2- of any more than fourfold measurably impaired growth, and a fivefold increase in O

126 ed residues 133 to 136 of the connector loop measurably impaired the UL44-UL54 interaction without al

127 nts with very large cysts, renal function is measurably impaired.

128 mpt insertion of tympanostomy tubes does not measurably improve developmental outcomes at the age of

129 o identify improvement opportunities, and to measurably improve patient experience.

130 movements only at (slower) speeds where they measurably improve performance.

131 social ties even among elderly residents can measurably improve their recoveries.

132 cluding high mortality rates, which have not measurably improved over the past decade.

133 erature shows that compassionate health care measurably improves physical and psychological patient o

134 We show that incorporating PRS measurably improves prediction accuracy for most cancers

135 owed that the use of more precise input data measurably improves the local precision and accuracy of

136 leukemia virus reverse transcriptase did not measurably incorporate the analogues, this enzyme bound

137 terenol, at a concentration of 1 nm, did not measurably increase intracellular cyclic adenosine monop

138 in with the NADPH-FAD subdomain but does not measurably increase its interaction with the oxygenase d

139 d spontaneous AP firing (<2 min) and did not measurably increase synaptic activity.

140 he use of PPIs in clinical practice does not measurably increase the risk of CRC.

141 cal testing before cataract surgery does not measurably increase the safety of the surgery.

142 to be very unstable, however, the stability measurably increased after 24-48 h of activation.

143 our of delay in initiating effective therapy measurably increases patient mortality.

144 with vimentin intermediate filaments (VIFs) measurably increases their membrane potential.

145 nd PBTSA3T, but less efficiently, reflecting measurably inferior morphology and nonoptimal energy lev

146 ce that both antibiotic use and connectivity measurably influence hospital AMR.

147 ar if many of these non-canonical miRNAs can measurably influence phenotypes.

148 the vast majority of hexamer sequence motifs measurably influence splice site selection when position

149 find that the FRAP bleach intensity does not measurably influence the diffusion in the samples, but t

150 save many lives in West Africa but will not measurably influence the prevalence.

151 Torques exerted by sublimation measurably influence the spin rates of active comets and

152 ctionally validated 14 of 21 genes tested as measurably influencing invasion and/or cytotoxicity, inc

153 ibodies raised against DNA ligase IV did not measurably inhibit end joining at 10 mM Mg(2+) in either

154 Because the phosphonate analogues measurably inhibited e-N (apparent Ki values of 6-12 mic

155 complete picture of the many components that measurably interact in a network manner to produce cellu

156 PD-L1, TGF-beta, and CTLA-2alpha were not measurably involved in RPE cell-induced MDSC differentia

157 group results in less steric interaction and measurably larger electron proton coupling constants.

158 mmadelta T cells (C57BL/6-derived) developed measurably less disease compared with untreated mice.

159 and bilaterality of AMD are associated with measurably lower HRQoL scores, with the largest differen

160 Clinically, we find that platelet forces are measurably lower in cardiology patients taking aspirin.

161 h strong political beliefs, individuals with measurably lower physical sensitivities to sudden noises

162 nterpart and the stability of metFixL*-CN is measurably lower than that of metFixLN-CN.

163 ength and, based on this analysis, created a measurably more accessible informed consent document.

164 transcripts, and produces annotation that is measurably more accurate than some evidence-based gene s

165 However, the 1999 isolate was measurably more cytotoxic to CD4(+) T cells than the 199

166 ntained interfibrillar reflections that were measurably more diffuse, a fact that points to a widespr

167 Immunity induced by the mutant was measurably more robust in all respiratory organs, provid

168 n years ago, archaebacterial sequences being measurably more similar to eukaryotic ones than are euba

169 linkage region, formed RNA dimers that were measurably more stable than WT.

170 f viral genomic epidemiology, namely that of measurably mutating pathogens, does not apply easily to

171 Our numerical results predict a measurably nonlinear force-deflection behavior at modera

172 ociation between beta-catenin and c-Neu that measurably occurs only in neoplasia, most strongly in me

173 , and the light-sensitive conductance is not measurably permeable to Ca2+.

174 oocytes, but we find that these channels are measurably permeable to Na2+ and Ca2+.

175 They do not measurably perturb sex chromosome segregation, suggestin

176 ariable under physiologic conditions, and is measurably prolonged by many drugs.

177 yclin/p53(-/-) lymphocytes in vitro were not measurably protected from DNA damage-induced apoptosis c

178 troduce the related but different concept of measurably recombining malaria parasites to promote conv

179 a selective COX-1 inhibitor, SC-560, did not measurably reduce tumor prostaglandin levels or tumor gr

180 hesion molecule-1 (ICAM-1) expression is not measurably reduced by either cell type under the same co

181 e-associated alpha-crystallin complexes have measurably reduced CLA compared to complexes in solution

182 transport nor cerebral glucose metabolism is measurably reduced in people with poorly controlled type

183 IL-4-induced CD23 expression was measurably reduced in the CD20- population as well.

184 These effects are measurably rescued by ectopic expression of mouse or hum

185 Rab9 can measurably reverse SifA-dependent LAMP1 recruitment and

186 brations of deoxyFixLN and deoxyFixL are not measurably shifted from those of their neutral counterpa

187 ibrational dephasing of the heme-bound CO is measurably slower for both MbCO and HbCO relative to tha

188 mal, the subpopulation of DN4 thymocytes was measurably smaller because of reduced proliferation and

189 We show that burned slopes are measurably smoother than vegetated slopes, leading to 1)

190 ilar experimental conditions, SGK displays a measurably stronger inhibitory effect on B-Raf kinase ac

191 It measurably suppressed the interferon antiviral pathway b

192 titutions nor double substitutions increased measurably the extent of FH19-20 self-association, nor d

193 Inhibition of AdSS by 5'-PH was measurably time-dependent.

194 Given that L-type VSCCs do not contribute measurably to Ca2+ influx in spines, they must activate

195 that, on average, protected areas contribute measurably to conserving bird species in some of the wor

196 H3, another virus isolate that does not bind measurably to DAF, adaptation to RD cells resulted in a

197 ATA-3(-/-) ES cells are unable to contribute measurably to the double-negative thymocyte population.

198 ly the early multiply spliced transcript was measurably translated.

199 bVMAT substrate tyramine, none of them were measurably transported into the granule.

200 le activity, and most fragments did not bind measurably, until they captured most of the substrate fe

201 Helical content did not change measurably upon photoactivation.

202 strain indicated that the stator-binding was measurably weaker when motors were unable to generate to

203 t1, Ccdc26 and Gsdmc fails to advance cancer measurably, whereas a single supernumerary segment encom

204 orpedo californica AChE, PMSF does not react measurably with the T. californica enzyme.