戻る
「早戻しボタン」を押すと検索画面に戻ります。 [閉じる]

コーパス検索結果 (1語後でソート)

通し番号をクリックするとPubMedの該当ページを表示します
1 (2) expression by their respective antisense oligodeoxyribonucleotide.
2 otin linkage and annealed to a complementary oligodeoxyribonucleotide.
3 comprised of a G-rich 18-mer triplex forming oligodeoxyribonucleotide.
4 N-acetoxy-PhIP, with a single-stranded 11mer oligodeoxyribonucleotide.
5 tive on the 5'-terminus of the support-bound oligodeoxyribonucleotide.
6 as incorporated into a short single-stranded oligodeoxyribonucleotide.
7  able to repair O6-benzylguanine in a 16-mer oligodeoxyribonucleotide.
8 er and was specifically competed by an Oct-1 oligodeoxyribonucleotide.
9 a cells to a calpain small subunit antisense oligodeoxyribonucleotide.
10 tween fivefold and 27-fold, depending on the oligodeoxyribonucleotide.
11 osphoramidite and used in the preparation of oligodeoxyribonucleotides.
12 ble and nonexchangeable protons for all four oligodeoxyribonucleotides.
13 from formal nucleotide deletion in synthetic oligodeoxyribonucleotides.
14 emolytic complement lysis than do control PS oligodeoxyribonucleotides.
15 such behavior in double- and triple-stranded oligodeoxyribonucleotides.
16 cts the ATPase activity of RecA protein with oligodeoxyribonucleotides.
17 hosphorothioate (PS) and phosphodiester (PO) oligodeoxyribonucleotides.
18 shed by pretreatment with antisense TGFbeta1 oligodeoxyribonucleotides.
19 nity for binding to native DNA and substrate oligodeoxyribonucleotides.
20 ibution, stability and radiotoxicity of 125I-oligodeoxyribonucleotides (125I-ODN) in human fibrosarco
21               Here we describe the use of an oligodeoxyribonucleotide 19mer psoralen-modified TFO to
22 the site-specific placement of 8 in a 12-mer oligodeoxyribonucleotide 26.
23 solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at
24                                              Oligodeoxyribonucleotides (5'-phosphorylated) of varying
25                                              Oligodeoxyribonucleotides (5'TCCTCCTG1G2-CCTCTC), modifi
26                                              Oligodeoxyribonucleotides ((5)(')GAGGTGCG(BPDE)TGTTTGT)
27                      Here we synthesize from oligodeoxyribonucleotides a completely de-novo-designed,
28                                              Oligodeoxyribonucleotides accumulated in the cell nucleu
29 eins adjuvanted with immunostimulatory (CpG) oligodeoxyribonucleotides admixed with either Alhydrogel
30 stranded 8-bromoguanine-containing synthetic oligodeoxyribonucleotide alone and in a duplex construct
31 rotein levels by PKCdelta-specific antisense oligodeoxyribonucleotides also inhibited 15-LO expressio
32 oligomers therefore represent a new class of oligodeoxyribonucleotide analogs having phosphorus- carb
33 n excess amount of a single base substituted oligodeoxyribonucleotide and distinguishes single nucleo
34 ort the synthesis of a novel trithiol-capped oligodeoxyribonucleotide and gold nanoparticle conjugate
35 serve as lateral spacers between neighboring oligodeoxyribonucleotides and as a linker arm between th
36 ct of laminin was reduced by using antisense oligodeoxyribonucleotides and DNA enzymes.
37 ic method was developed for the synthesis of oligodeoxyribonucleotides and oligodeoxyribonucleoside m
38 nD were investigated by using JunD antisense oligodeoxyribonucleotides and transient transfection wit
39 ch as ribozymes, antisense RNA and antisense oligodeoxyribonucleotides, and for optimizing the design
40  complexes formed with 16-, 30-, and 80-base oligodeoxyribonucleotides are 3.8 +/- 0.3, 5.3 +/- 0.2,
41  this prediction showing that antisense junD oligodeoxyribonucleotides are mitogenic for differentiat
42 ion of 5-iodouridine at thymine sites of the oligodeoxyribonucleotide as an additional photoreactive
43 re introduced onto the 5'-end of a synthetic oligodeoxyribonucleotide as the last step of an automate
44          Using a biotinylated homopyrimidine oligodeoxyribonucleotide as third-strand probe, TAC is p
45 bility of RecA protein to hydrolyze UTP with oligodeoxyribonucleotides as cofactor and the ability of
46 sequence was observed using 12-mer synthetic oligodeoxyribonucleotides as substrates and as DNA seque
47 2) protein expression, mediated by antisense oligodeoxyribonucleotides (AS-ODN) specific for cPLA(2)
48 yethoxy (MOE) nucleotides into the antisense oligodeoxyribonucleotide (ASO) of the heteroduplex to al
49 ding small-molecule inhibitors and antisense oligodeoxyribonucleotides (ASON), are undergoing clinica
50 odified nucleotides were introduced into the oligodeoxyribonucleotide at the catalytic site of the he
51   Ribozyme efficacy was first assessed by an oligodeoxyribonucleotide-based assay to identify the mos
52 n of PKC epsilon protein levels by antisense oligodeoxyribonucleotides blocks MAPK activation in resp
53 d from monothiol and cyclic disulfide-capped oligodeoxyribonucleotides, but comparable hybridization
54 gth impurities was isolated from a synthetic oligodeoxyribonucleotide by PAGE and labeled with 35S.
55 arboxamide was incorporated into a series of oligodeoxyribonucleotides by solid-phase phosphoramidite
56           Significantly, this novel trithiol oligodeoxyribonucleotide can be used to stabilize partic
57 that gamma irradiation of a synthetic duplex oligodeoxyribonucleotide can give rise to an intrastrand
58               The nuclease resistance of the oligodeoxyribonucleotides capped with guanidinium linkag
59 isense but not by sense or missense TGFbeta1 oligodeoxyribonucleotides caused essentially complete in
60 ssion of synexin was down-regulated using an oligodeoxyribonucleotide complementary to the synexin mR
61                    By using phosphorothioate oligodeoxyribonucleotides complementary to the region of
62        Despite the small footprint, however, oligodeoxyribonucleotides comprising <15 bp with a hypox
63 ion at room temperature with a complementary oligodeoxyribonucleotide containing 2-fluoro-2'-deoxyino
64 hyltransferase (M.HhaI), AdoMet and a target oligodeoxyribonucleotide containing 5-fluorocytosine con
65                                           An oligodeoxyribonucleotide containing a heptane cross-link
66 -l-homocysteine and a double-stranded 13-mer oligodeoxyribonucleotide containing DZCyt at the target
67 8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines wa
68  new method is reported for the synthesis of oligodeoxyribonucleotides containing 2-aminopurine resid
69                                        Short oligodeoxyribonucleotides containing a central b(6)G are
70 de-induced chemical ligation, four 27-member oligodeoxyribonucleotides containing a pyrophosphate int
71 poration into DNA, we chemically synthesized oligodeoxyribonucleotides containing a single dG(s) (11
72 iazoacetate exposure, and the preparation of oligodeoxyribonucleotides containing a site-specifically
73 sequence context, we used 13 different 25 bp oligodeoxyribonucleotides containing a unique hypoxanthi
74                                              Oligodeoxyribonucleotides containing CpG dinucleotides (
75                                    Synthetic oligodeoxyribonucleotides containing CpG-dinucleotides (
76                                              Oligodeoxyribonucleotides containing DZCyt formed a tigh
77 for antisense therapeutics, we have prepared oligodeoxyribonucleotides containing more than 200 diffe
78  examined whether human AGT could react with oligodeoxyribonucleotides containing multiple b(6)G resi
79 both ATL proteins bind with high affinity to oligodeoxyribonucleotides containing O(6)-alkylguanines
80 as also observed with single-stranded 16-mer oligodeoxyribonucleotides containing O(6)-methylguanine,
81                                              Oligodeoxyribonucleotides containing pseudorotationally
82                   We now show that synthetic oligodeoxyribonucleotides containing the known MGMT subs
83 In order to trap a covalent AGT-DNA complex, oligodeoxyribonucleotides containing the novel nucleosid
84                                              Oligodeoxyribonucleotides containing the nucleoside anal
85                                              Oligodeoxyribonucleotides containing thymidine and 8-oxo
86                                              Oligodeoxyribonucleotides containing unmethylated CpG mo
87  between HhaI methyltransferase (M.HhaI) and oligodeoxyribonucleotides containing ZCyt at the target
88 hat incorporate O(6)-alkylguanine adducts in oligodeoxyribonucleotide contexts.
89      Primers employed in the PCR represented oligodeoxyribonucleotides corresponding to conserved ami
90                                         Such oligodeoxyribonucleotides could form the basis for the d
91                                          The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT),
92                                          The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTC
93 tudies are reported for two nine-residue DNA oligodeoxyribonucleotides, d(CATGGGTAC).d(GTACNCATG) (1)
94  stability and conformation of the antisense oligodeoxyribonucleotides, d[CGCGTT x TTGCGC] [x = phosp
95            Earlier reports using OsBp-tagged oligodeoxyribonucleotides demonstrated proof-of-principl
96 ically modified and stereochemically defined oligodeoxyribonucleotides derived from the covalent reac
97                                              Oligodeoxyribonucleotides designed to block particular t
98 nor hearts with a phosphorothioate antisense oligodeoxyribonucleotide directed against Egr-1 before o
99 onor lungs with a phosphorothioate antisense oligodeoxyribonucleotide directed against the Egr-1 tran
100 Transfecting cortical neurons with antisense oligodeoxyribonucleotides directed against NP1 mRNA (NP1
101                     In the case of synthetic oligodeoxyribonucleotide drugs, however, product complex
102 ific near-infrared (NIR) fluorophore-labeled oligodeoxyribonucleotide duplex (ODND) probes.
103  the interactions of NF-kappaB proteins with oligodeoxyribonucleotide duplexes containing kappaB site
104 ame complex was also shown to bind synthetic oligodeoxyribonucleotide duplexes containing the nonnatu
105 stics of bends in site-specifically modified oligodeoxyribonucleotide duplexes induced by single (+)-
106 scarbamylase (OTC) by recursive PCR using 18 oligodeoxyribonucleotides, each 70-80 nucleotides in len
107 de and was attached to the 5'-terminus of an oligodeoxyribonucleotide following a reverse coupling pr
108 interventional phase III trials of antisense oligodeoxyribonucleotides for a cancer indication will b
109   The major hurdle associated with utilizing oligodeoxyribonucleotides for therapeutic purposes is th
110 at could be reversed by removal of antisense oligodeoxyribonucleotide from the culture medium.
111 thesis and triplex stabilizing properties of oligodeoxyribonucleotides functionalized at the 5'- and/
112 cence studies using 2-aminopurine-containing oligodeoxyribonucleotides further revealed the sequentia
113               Single-stranded guanosine-rich oligodeoxyribonucleotides (GROs) have a propensity to fo
114 pacity compared with hypoxanthine-containing oligodeoxyribonucleotides &gt;20 bp in length.
115 cytosine in G-C-G-C sites in double-stranded oligodeoxyribonucleotides had a similar effect on methyl
116 e recombinant human MPG protein from a 39 bp oligodeoxyribonucleotide harboring a unique hypoxanthine
117                       Herein, we synthesized oligodeoxyribonucleotides harboring eight site-specifica
118         In the present study, we synthesized oligodeoxyribonucleotides harboring seven O(2)-alkyldT l
119       A novel method for the deprotection of oligodeoxyribonucleotides has been developed.
120                                              Oligodeoxyribonucleotides have been constructed with the
121                                 For example, oligodeoxyribonucleotides having a (tert-butyl)phenoxyac
122 ditions, only the perfectly sequence-matched oligodeoxyribonucleotide hybridized to each probe, while
123 etric data indicate that the single-stranded oligodeoxyribonucleotides hydrate very similarly to dupl
124 potent as inhibitors of DNA methylation than oligodeoxyribonucleotides identical in sequence containi
125 en antigen, conjugated to a phosphorothioate oligodeoxyribonucleotide immunostimulatory sequence of D
126 or automated synthesis of double dye-labeled oligodeoxyribonucleotides in high yield.
127                           PKCdelta antisense oligodeoxyribonucleotides inhibited the phosphorylation
128  STAT1 and STAT3 transcription factor decoys oligodeoxyribonucleotides into PC12 cells, nicotine indu
129 DNA methyltransferase covalently bound to an oligodeoxyribonucleotide is not efficiently excised by u
130          Attachment of sulfhydryl-terminated oligodeoxyribonucleotides is highly site specific, and i
131 s on spectral bands in these single-stranded oligodeoxyribonucleotides is markedly different from suc
132                       Facile modification of oligodeoxyribonucleotides is required for efficient immo
133                         The cleavage rate of oligodeoxyribonucleotides is significantly increased by
134  DNA and related synthetic immunostimulatory oligodeoxyribonucleotides (ISS-ODN) stimulate innate imm
135                      Immunostimulatory CpG-C oligodeoxyribonucleotides (ISS-ODNs) represent a promisi
136 g., CD40L) and TLRs (e.g., immunostimulatory oligodeoxyribonucleotides (ISS-ODNs)) is crucial for max
137               Incubation of AGT with DBE and oligodeoxyribonucleotides led to the formation of covale
138 e with 1,2-dibromoethane and single-stranded oligodeoxyribonucleotides led to the formation of covale
139 yzed in reactions in which the cofactors are oligodeoxyribonucleotides less than approximately 50 nt
140                          We demonstrate that oligodeoxyribonucleotides modified with the correspondin
141                                          The oligodeoxyribonucleotide-modified surfaces were extremel
142 id duplex formed by a methylphosphonate (MP) oligodeoxyribonucleotide (MPO) and its target oligoribon
143                           Uniformly modified oligodeoxyribonucleotide N3'-->P5' phosphoramidates cont
144 f novel nucleic acid analogs, alpha-anomeric oligodeoxyribonucleotide N3'-->P5' phosphoramidates, are
145 dation of 1-methyladenine in poly(dA), short oligodeoxyribonucleotides, nucleotides, and nucleoside t
146        In addition, the microinjection of an oligodeoxyribonucleotide (OD) directed against cat NGF m
147 e marrow and treated with NF-kappaB-specific oligodeoxyribonucleotide (ODN) in vitro (NF-kappaB ODN D
148 ng three different adjuvants showed that CpG oligodeoxyribonucleotide (ODN) induces very low levels o
149 with polyethylene glycol was used to improve oligodeoxyribonucleotide (ODN) loading, stability of the
150 ived a daily injection of TNFalpha antisense oligodeoxyribonucleotide (ODN) or control on days 1 thro
151 esigned and tested prototype NIR fluorescent oligodeoxyribonucleotide (ODN) reporters that can sense
152                             Kir6.2 antisense oligodeoxyribonucleotide (ODN) was then administered dai
153 though iPLA(2)beta or cPLA(2)alpha antisense oligodeoxyribonucleotide (ODN)-treated monocytes display
154 e designed a new class of modified antisense oligodeoxyribonucleotides (ODN) consisting of a central
155 ir maturation was arrested by treatment with oligodeoxyribonucleotides (ODN) specifically against nuc
156 dual PKC isoforms, we chose to use antisense oligodeoxyribonucleotides (ODN) to specifically reduce P
157 attractive target for therapy with antisense oligodeoxyribonucleotides (ODN).
158 nthetic polyamines on the conformation of an oligodeoxyribonucleotide (ODN1) harboring the estrogen r
159 hosphodiester (PO) and phosphorothioate (PS) oligodeoxyribonucleotides (ODNs) (21-mer) targeted to th
160  in 15-LO expression, we generated antisense oligodeoxyribonucleotides (ODNs) against Tyk2 and Jak2.
161                                              Oligodeoxyribonucleotides (ODNs) bearing the reactive ni
162                             Guanine (G)-rich oligodeoxyribonucleotides (ODNs) can form undesired comp
163 n containing a tryptophan (Trp) reporter and oligodeoxyribonucleotides (ODNs) containing a fluorescen
164 ch can be blocked by double-stranded "decoy" oligodeoxyribonucleotides (ODNs) containing binding site
165  we have identified partial phosphorothioate oligodeoxyribonucleotides (ODNs) containing C-5 propynyl
166                                    Synthetic oligodeoxyribonucleotides (ODNs) containing CpG (unmethy
167     Sequencing reactions were conducted with oligodeoxyribonucleotides (ODNs) containing d(Me)isoC an
168 port, for the first time, the preparation of oligodeoxyribonucleotides (ODNs) containing individual d
169 cess for the first time to a wide variety of oligodeoxyribonucleotides (ODNs) containing O6-alkylguan
170       We have synthesised 5'-psoralen linked oligodeoxyribonucleotides (ODNs) containing thymidine (d
171 ense, but not sense, nonsense, or scrambled, oligodeoxyribonucleotides (ODNs) decreased DNA synthesis
172                However, the efficacy of such oligodeoxyribonucleotides (ODNs) depends on efficient in
173                                    Synthetic oligodeoxyribonucleotides (ODNs) designed to selectively
174 of transduction with high-affinity antisense oligodeoxyribonucleotides (ODNs) designed to target the
175 highest binding affinities, while pyrimidine oligodeoxyribonucleotides (ODNs) did not show appreciabl
176 ted, solid-phase synthesis of mixed backbone oligodeoxyribonucleotides (ODNs) having 1,2,3-triazolylp
177                The biophysical properties of oligodeoxyribonucleotides (ODNs) selectively modified wi
178 ofuranosyl nucleosides)] into antisense (AS) oligodeoxyribonucleotides (ODNs) should greatly improve
179 cultures treated with HSV DNA or HSV-derived oligodeoxyribonucleotides (ODNs) showed strong prolifera
180 e we report the synthesis of phosphotriester oligodeoxyribonucleotides (ODNs) that are stable to the
181                                     Modified oligodeoxyribonucleotides (ODNs) that have unique hybrid
182  the native, endogenous mRNA is probed using oligodeoxyribonucleotides (ODNs) to identify RNase H-acc
183 lently linked to the 5' or 3' end of several oligodeoxyribonucleotides (ODNs) totally complementary o
184 or the highly efficient chemical ligation of oligodeoxyribonucleotides (ODNs) using cyanogen bromide
185              We have attached racemic CPI to oligodeoxyribonucleotides (ODNs) via a terminal phosphor
186                                              Oligodeoxyribonucleotides (ODNs) were prepared with 111I
187 tor system using nitrogen mustard-conjugated oligodeoxyribonucleotides (ODNs).
188 l radical (I) in single- and double-stranded oligodeoxyribonucleotides (ODNs).
189  addition of micromolar concentrations of an oligodeoxyribonucleotide of arbitrary sequence to the tu
190 he target strands compared with an all 3'-5'-oligodeoxyribonucleotide of the same sequence and length
191                                          The oligodeoxyribonucleotides of this hairpin stem-loop arch
192 ated synthesis on 0.2-1.0 micromol scales of oligodeoxyribonucleotides, of length 6-20 bases, contain
193                                        Using oligodeoxyribonucleotide (oligo) primers based on the se
194  RT-PCR using human cerebral cortex mRNA and oligodeoxyribonucleotide (oligo) primers derived from th
195    Following Edman degradation, three 17-mer oligodeoxyribonucleotide (oligo) probes corresponding to
196                                  A wild type oligodeoxyribonucleotide (oligo) spanning the mouse alph
197 that the nuclear factor binding to the FP160 oligodeoxyribonucleotide (oligo) was competed by oligos
198                The potential of guanine-rich oligodeoxyribonucleotides (oligos) as nucleic acid drugs
199 edure for generating long primers from short oligodeoxyribonucleotides (oligos) to incorporate DNA cr
200                         Double-stranded (ds) oligodeoxyribonucleotides (oligos) were immobilized in 9
201 ichia coli RNA polymerase of single-stranded oligodeoxyribonucleotides (oligos) with the sequence of
202 HER2/neu-specific phosphorothioate antisense oligodeoxyribonucleotides on HER2/neu expression, tumor
203  when incubated with a mixture of two 16-mer oligodeoxyribonucleotides, one containing O6-benzylguani
204 ynthesis and biophysical characterization of oligodeoxyribonucleotides (ONs) modified with 2'-amino-a
205                                 For example, oligodeoxyribonucleotides (ONs) modified with 2'-O-(coro
206 dites were synthesized and incorporated into oligodeoxyribonucleotides (ONs), which were then charact
207 oieties and incorporated these monomers into oligodeoxyribonucleotides (ONs).
208 ansferases to generate unique DPC adducts in oligodeoxyribonucleotides or plasmids to monitor both in
209 biological origin, such as oligopeptides and oligodeoxyribonucleotides, or with intact native protein
210     Dicer-substrate siRNAs equipped with CpG oligodeoxyribonucleotides overcome the major hurdle in c
211      Homopurine (AG) and homopyrimidine (CT) oligodeoxyribonucleotides predicted to form triple-helic
212 ted from an 18-nucleotide (nt) oligoribo- or oligodeoxyribonucleotide primer complementary to the pri
213  (KF) as a model proofreading polymerase and oligodeoxyribonucleotide primer/templates as model DNA s
214  microorganisms in clinical specimens employ oligodeoxyribonucleotide primers and probes for specific
215 lification method utilizing a circularizable oligodeoxyribonucleotide probe (C-probe).
216  the synthesis of a radioactive, photolabile oligodeoxyribonucleotide probe and its exploitation in i
217  the synthesis of a radioactive, photolabile oligodeoxyribonucleotide probe and its exploitation in i
218 te constants and thermodynamic affinities of oligodeoxyribonucleotide probes binding to simple synthe
219                           The assay utilizes oligodeoxyribonucleotide probes labeled with a highly ch
220                         A complete series of oligodeoxyribonucleotide probes were designed, each comp
221 yuridine in both single- and double-stranded oligodeoxyribonucleotides provided much better substrate
222 ing gene-specific antisense phosphorothioate oligodeoxyribonucleotides (PS-ODNs) by the addition of 5
223 specific antisense phosphorothioate-modified oligodeoxyribonucleotides (PS-ODNs) targeting different
224 dicals, G(-H)* in single- or double-stranded oligodeoxyribonucleotides (rate constant of 4.7 +/- 1.0
225 '-5'-ribonucleoside incorporation into 3'-5'-oligodeoxyribonucleotides reduces binding to the target
226 e preparation of phosphorothioate-containing oligodeoxyribonucleotides rely on the reaction of phosph
227 Analysis of MPG protein binding to the 39 bp oligodeoxyribonucleotide revealed that the apparent diss
228      We have developed a system to carry out oligodeoxyribonucleotide-RNA and ribozyme-RNA binding ex
229 ybridization with antisense phosphorothioate oligodeoxyribonucleotides (S-DNAs).
230 g site incorporated within a double-stranded oligodeoxyribonucleotide sequence even in the presence o
231 r, the nature of the protein domain, and the oligodeoxyribonucleotide sequences flanking the platinat
232                      Four self-complementary oligodeoxyribonucleotide sequences were prepared and stu
233 th, double-stranded, hypoxanthine-containing oligodeoxyribonucleotides show that the footprinted regi
234 re, by transfecting monocytes with the decoy oligodeoxyribonucleotides specific for Egr-1 and CREB, w
235 ecific molecularly imprinted single-stranded oligodeoxyribonucleotide (ss-ODN) biosensor was fabricat
236 talytic turnover using a hydrolyzable duplex oligodeoxyribonucleotide substrate containing a uracil:2
237 enced by the stoichiometric reaction with an oligodeoxyribonucleotide substrate.
238 , together with the preparation of authentic oligodeoxyribonucleotide substrates housing these two le
239 otides of single-stranded or double-stranded oligodeoxyribonucleotide substrates led to complete inhi
240                                        Model oligodeoxyribonucleotide substrates representing viral D
241 talyzed reaction with small, single-stranded oligodeoxyribonucleotide substrates under single-turnove
242                        Human triplex-forming oligodeoxyribonucleotide (TFO) formed stable triplexes e
243 active group conjugated to a triplex forming oligodeoxyribonucleotide (TFO) that binds in the major g
244 e within a mammalian gene, a triplex-forming oligodeoxyribonucleotide (TFO) that binds with high affi
245               Synthetic triple helix-forming oligodeoxyribonucleotides (TFOs) have been used to alter
246    To explore the ability of triplex-forming oligodeoxyribonucleotides (TFOs) to inhibit genes respon
247  substituent, adamantylcarbamoyl, yielded an oligodeoxyribonucleotide that dissociated with a T m of
248             The thrombin aptamer is a 15-mer oligodeoxyribonucleotide that folds into a unimolecular
249  backbone on the reactions of cisplatin with oligodeoxyribonucleotides that lack or contain a GTG seq
250  that endo VIII removes from double-stranded oligodeoxyribonucleotides the stable oxidative products
251 c AP site-lysine-cross-linked peptide and an oligodeoxyribonucleotide, the method was used to determi
252  sequence d(TG)n than with any homopolymeric oligodeoxyribonucleotide; thus, it shows a strong sequen
253 tracerebroventricular injection of antisense oligodeoxyribonucleotide to Kv1.1 reduces expression of
254 th specific antibodies showed that antisense oligodeoxyribonucleotide to Kv1.4 microinjected intraven
255                       Binding of the labeled oligodeoxyribonucleotide to the beads was indicative of
256 e, when M21 cells transfected with antisense oligodeoxyribonucleotide to the hnRNP L RNA-binding site
257 chemistry with subunit-specific 35S-labelled oligodeoxyribonucleotides to examine these mRNAs in adul
258 microtiter-based assay to measure binding of oligodeoxyribonucleotides to nucleic acid targets.
259                              Using antisense oligodeoxyribonucleotide treatment we found that iPLA(2)
260 duplex DNA sequence recognized by a G/T-rich oligodeoxyribonucleotide under conditions favoring purin
261 accuracy was adequate to verify sequences of oligodeoxyribonucleotides up to 9500-Da molecular mass.
262 mino groups can be coupled to thiol-modified oligodeoxyribonucleotides using a heterobifunctional cro
263 e of the phosphodiester linkage by NaOH, the oligodeoxyribonucleotide was attached to streptavidin-co
264                                          The oligodeoxyribonucleotide was labeled at the 5' end with
265        The 35S signal intensity of the bound oligodeoxyribonucleotide was proportional to the concent
266 ed phosphonoacetate and thiophosphonoacetate oligodeoxyribonucleotides were chemically synthesized an
267 thods for controlling the surface density of oligodeoxyribonucleotides were explored: in the first, b
268                             Phosphonoformate oligodeoxyribonucleotides were prepared via a solid phas
269 ected with 9-fluorenylmethyloxycarbonyl, and oligodeoxyribonucleotides were synthesized on controlled
270                                        Small oligodeoxyribonucleotides were used as DNA cofactors in
271 ical inhibitors, PKCdelta-specific antisense oligodeoxyribonucleotides were used.
272                      This report presents an oligodeoxyribonucleotide which contains a hairpin stem-l
273 e this process, pDCs were activated with CpG oligodeoxyribonucleotides, which stimulated the secretio
274                                  However, an oligodeoxyribonucleotide with a butane cross-link was a
275 nting experiments with the MPG protein on an oligodeoxyribonucleotide with a unique hypoxanthine at a
276                    The substrate used was an oligodeoxyribonucleotide with a unique hypoxanthine base
277 utarate Fe(II) dioxygenase activity using an oligodeoxyribonucleotide with a unique modification show
278 ibition comparable with that of a control PS oligodeoxyribonucleotide with all 3'-5'linkages.
279 sidue is easily verified by treatment of the oligodeoxyribonucleotide with hot piperidine.
280                            The corresponding oligodeoxyribonucleotides with 3-nitropyrrole in the sam
281                          Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide reve
282                            The corresponding oligodeoxyribonucleotides with dI or dA in the same posi
283 ome commonly used fluorophores conjugated to oligodeoxyribonucleotides with different primary and sec
284 bles successful incorporation of SP TpT into oligodeoxyribonucleotides with high efficiency via stand
285 mide moiety, was incorporated into synthetic oligodeoxyribonucleotides with the use of a benzoyl prot
286 -benzyl or -methyl groups when present in an oligodeoxyribonucleotide without altering the reaction w
287 for cleavage and deprotection of dye-labeled oligodeoxyribonucleotides without any degradation or mod

 
Page Top