ライフサイエンスコーパス: solid-phase synthesis

1 efined sites were chemically synthesized via solid phase synthesis.

2 yl ring of Phe(3) or Phe(4) were prepared by solid phase synthesis.

3 hat cannot be accessed by standard divergent solid phase synthesis.

4 ed favorably to vendor produced samples from solid phase synthesis.

5 l)oxy)butanoyl (SoA) group as the linker for solid phase synthesis.

6 phosphonium cation via a lysine linker using solid phase synthesis.

7 t the 2'-position of uridine by conventional solid-phase synthesis.

8 inker was incorporated into the conjugate by solid-phase synthesis.

9 ection provided building blocks suitable for solid-phase synthesis.

10 longer oligomers and for the development of solid-phase synthesis.

11 integrated into longer peptoid sequences via solid-phase synthesis.

12 ND1 probes as well as mismatched controls by solid-phase synthesis.

13 deglycobleomycin analogues through parallel solid-phase synthesis.

14 to carrier proteins, in a natural analogy to solid-phase synthesis.

15 tterer into oligonucleotides by conventional solid-phase synthesis.

16 ) has been incorporated into a peptide using solid-phase synthesis.

17 their incorporation into oligonucleotides by solid-phase synthesis.

18 uanidinylation reagent both in solution- and solid-phase synthesis.

19 an be integrated into automated oligopeptide solid-phase synthesis.

20 th the classical solution-phase reaction and solid-phase synthesis.

21 rated into a series of G-rich DNA strands by solid-phase synthesis.

22 -ladder oligomers (spiroligomers) by modular solid-phase synthesis.

23 tides and is applicable to both solution and solid-phase synthesis.

24 tides were incorporated into RNA strands via solid-phase synthesis.

25 hat is suitably protected for utilization in solid-phase synthesis.

26 lly protected furanoid SDAs and their use in solid-phase synthesis.

27 d and incorporated into oligonucleotides via solid-phase synthesis.

28 Methods: The precursors were obtained by solid-phase synthesis.

29 be directly covalently linked to DNA during solid-phase synthesis.

30 ock copolypeptoids synthesized by submonomer solid-phase synthesis.

31 timate N-terminal position were prepared via solid-phase synthesis.

32 nto an a-factor-derived peptide produced via solid-phase synthesis.

33 ) were incorporated into oligonucleotides by solid-phase synthesis.

34 they are prepared either enzymatically or by solid-phase synthesis.

35 methyluridine were chemically synthesized by solid-phase synthesis.

36 ucleotides with high efficiency via standard solid-phase synthesis.

37 yl)glyc ine) (pNte-b-pNeh), were obtained by solid-phase synthesis.

38 osphoramidites were prepared and employed in solid-phase synthesis.

39 abel for paramagnetic modification of RNA by solid-phase synthesis.

40 to a target RNA via chemical oligonucleotide solid-phase synthesis.

41 ch is considerably cheaper than conventional solid-phase synthesis.

42 s were incorporated into oligonucleotides by solid-phase synthesis.

43 f side chains can be incorporated via facile solid-phase synthesis.

44 g atom into oligonucleotides by conventional solid-phase synthesis.

45 beled antimicrobial peptide BODIPY-cPAF26 by solid-phase synthesis (6-7 d) and its spectral and biolo

46 ptide substrates is typically carried out by solid-phase synthesis, a method that is not ideal for pr

47 covalent chemistry, advanced applications to solid-phase synthesis, a revival of transannular reactio

48 all short synthesis duration, the convergent solid phase synthesis allowed us to chemically synthesiz

49 We developed a strategy based on solid phase synthesis and post-functionalization to intr

50 cellular thiol/disulfide redox biology, for solid phase synthesis and purification, and for stimulus

51 ng antibodies used in ELISA were produced by solid phase synthesis and used in MINA for FB1 determina

52 ocortin 4 receptor (hMC4R), were prepared by solid phase synthesis and were N-terminally acylated wit

53 Here we report the solid-phase synthesis and analysis of peptide-linked, sp

54 Using solid-phase synthesis and bespoke phosphoramidites, the

55 cates that well-characterized MAPs combining solid-phase synthesis and conjugation chemistries are po

56 analogues at defined sites were prepared by solid-phase synthesis and in some cases enzymatic ligati

57 The total solid-phase synthesis and in vitro biological activity o

58 hese two natural products using an efficient solid-phase synthesis and late-stage macrolactamization

59 ared the putative ancestral human peptide by solid-phase synthesis and named it "retrocyclin." Retroc

60 Using solid-phase synthesis and native chemical ligation, we c

61 f a coumarin-based photocleavable anchor for solid-phase synthesis and nonchromatographic purificatio

62 complementary production strategies based on solid-phase synthesis and recombinant expression in Esch

63 serine and threonine were synthesized using solid-phase synthesis and subjected to reaction with tri

64 lic molecules by TE catalysis, we report the solid-phase synthesis and TE-mediated cyclization of a s

65 d 7-deaza-m(6)A nucleosides were prepared by solid-phase synthesis and their RNA binding and demethyl

66 ite 8b into the oligonucleotide chain during solid-phase synthesis and, optionally, through subsequen

67 nding catechol domains were obtained through solid phase synthesis, and their binding affinity to hyd

68 thesized using standard photolithography and solid-phase synthesis, and is able to sequence >29 kb of

69 , shorter than full-length sequences) during solid-phase synthesis; and (iii) be completely cleaved f

70 e in chemical synthesis is not necessary and solid-phase synthesis apparatus is routinely available i

71 The solid-phase synthesis applied here to epothilone A could

72 ucosamine (GlcN sulfoforms) were prepared by solid-phase synthesis as models of internal glucosamines

73 f peptide-based catalysts was synthesized on solid-phase synthesis beads such that each individual be

74 ile (diethylenetriamine) building blocks for solid-phase synthesis bearing Fmoc/Boc and Fmoc/Alloc pr

75 placements, which are easily implemented via solid-phase synthesis, can generate peptide hormone anal

76 ssed and compared to a specifically prepared solid-phase synthesis counterpart through gel electropho

77 bone along with the aptamer is assembled via solid-phase synthesis, followed by installation of poly(

78 ing peptidomimetic scaffolds are prepared by solid-phase synthesis from a single, versatile class of

79 The highly refined organic chemistry in solid-phase synthesis has made it the method of choice n

80 Although recent advancements in solid-phase synthesis have made the construction of comp

81 The ease of preparation, high affinity of solid-phase synthesised imprinted nanoparticles and the

82 we report a strategy that takes advantage of solid-phase synthesis in the assembly of the precursors

83 ions were synthesized and introduced through solid-phase synthesis into 15-mer oligodeoxynucleotide,

84 Automated solid-phase synthesis is an attractive technique for the

85 cited in the sentence that starts "Moreover, solid-phase synthesis is generally difficult to scale up

86 at can be incorporated into a peptide during solid-phase synthesis, is a useful probe for investigati

87 Besides solid-phase synthesis, isotope-labeled peptides are also

88 10 uses solid-phase synthesis; it does not, and is a purely liqu

89 Incorporation of these monomer units into solid-phase synthesis led to the efficient synthesis of

90 A-DOTA and LLP2A-CB-TE2A were prepared using solid-phase synthesis; LLP2A-DOTA-PEG(2,000), LLP2A-DOTA

91 produced for adenovirus by employing a novel solid phase synthesis method.

92 A highly efficient solid-phase synthesis method for the preparation of fluo

93 e/aptamer complexes were synthesized using a solid-phase synthesis method that involved the bio-conju

94 the template was investigated using a novel solid-phase synthesis method to obtain the artificial af

95 Here, we describe a solid-phase synthesis methodology for the efficient cons

96 o the single enantiomers; its application to solid-phase synthesis methodology gave a series of monom

97 Fmoc-based solid-phase synthesis methodology was used to prepare pe

98 dazole polyamides, coupled with an efficient solid-phase synthesis methodology, identify a powerful c

99 hendione metal complexes using combinatorial solid-phase synthesis methodology.

100 design allows the use of rapid and efficient solid-phase synthesis methods and the modular implementa

101 s of the approaches presented are the use of solid-phase synthesis methods for the generation of a co

102 ng 9-fluorenylmethyloxycarbonyl (Fmoc)-based solid-phase synthesis; N(alpha)-Fmoc-dl-hydroxy-dl-Lys(N

103 This work is expected to enable the solid phase synthesis of both natural and synthetic anal

104 e glycopeptide 1 was synthesized using a new solid phase synthesis of carbohydrates and a convergent

105 in, we demonstrate the first-ever convergent solid phase synthesis of dendrons, up to fourth generati

106 d -COOH activation to accomplish an atypical solid phase synthesis of diverse glutamic acid dendrons

107 This approach was applied to the solid phase synthesis of glycosylated forms of the 34 am

108 three segments due to the current limits of solid phase synthesis of individual peptide segments.

109 Solid phase synthesis of indolicidin gave rise to a mino

110 s study offers a simple designer approach to solid phase synthesis of macrocyclic peptides and lantib

111 escribe a microfluidic platform for parallel solid phase synthesis of oligonucleotides that can great

112 coupling activator during routine automated solid phase synthesis of oligonucleotides.

113 A catalyst that allows solid phase synthesis of peptides in benign solvents wit

114 We report here the solid phase synthesis of RNA and DNA oligonucleotides co

115 -dimethoxytrityl)-10-undecenoic acid, to the solid phase synthesis of RNA molecules is described.

116 ual-linker system has been developed for the solid phase synthesis of sterically hindered amides.

117 ether with the Nbz linker for Fmoc chemistry solid phase synthesis of the glycopeptide-(alpha) thioes

118 shed by a novel route involving an efficient solid phase synthesis of the peptide fragment and an eff

119 The solid-phase synthesis of 1,5-disubstituted 2-aryliminoim

120 on a solid support has permitted the facile solid-phase synthesis of 108 unique deglycobleomycin ana

121 A traceless approach for the parallel solid-phase synthesis of 2-arylamino-substituted quinazo

122 are described along with a protocol for the solid-phase synthesis of 21mer alpha PNAs containing fiv

123 to the corresponding phosphoramidite enables solid-phase synthesis of [2'-(18)O] RNA substrates for i

124 The solid-phase synthesis of a 1976-membered library of spir

125 The solid-phase synthesis of a cyclic peptide containing the

126 and bromoacetic acid are used in the facile solid-phase synthesis of a diverse family of sequence-sp

127 We report here the solid-phase synthesis of a DNA-encoded library of severa

128 affect protein palmitoylation, we report the solid-phase synthesis of a fluorescent cell-permeable pa

129 In a conventional five-step solid-phase synthesis of a hydantoin, similar results we

130 Previously, we described the solid-phase synthesis of a library of 108 unique analogu

131 otocol describes a general procedure for the solid-phase synthesis of a library of N-acyl aminocoumar

132 The parallel, asymmetric solid-phase synthesis of a small library of chiral keton

133 is orthogonally protected lanthionine in the solid-phase synthesis of an analogue of a fragment of ni

134 The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then c

135 We report an optimized protocol for the solid-phase synthesis of backbone-N-aminated peptides.

136 We recently optimized the solid-phase synthesis of beta-peptides using microwave i

137 A highly efficient and general solid-phase synthesis of bicyclic pyrimidine derivatives

138 on the mineral surfaces in a manner akin to solid-phase synthesis of biopolymers.

139 Envisioning an automated solid-phase synthesis of blood group determinants, the u

140 We report an efficient solid-phase synthesis of C-terminal tyrosine peptide ald

141 upports will have generic application in the solid-phase synthesis of combinatorial libraries and the

142 The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its

143 The first stepwise solid-phase synthesis of deoxynucleic guanidine (DNG), a

144 Although high-throughput methods for solid-phase synthesis of DNA sequences are currently ava

145 ble with the cleavage conditions used in the solid-phase synthesis of DNA.

146 Here we report the first solid-phase synthesis of epothilone A, the total synthes

147 Trp-BODIPY PLUS), and its implementation for solid-phase synthesis of fluorescent bioactive peptides.

148 tostable amino acids for the straightforward solid-phase synthesis of fluorescent peptides.

149 The solid-phase synthesis of Gly-W[CH(CF(3))NH]-peptides is

150 The solid-phase synthesis of glycopeptides containing the su

151 es has been developed via microwave-assisted solid-phase synthesis of hairpin amino acid oligomer int

152 A method for the solid-phase synthesis of individual cyclic depsipeptides

153 A five-step solid-phase synthesis of isoxazolinopyrrole-2-carboxylat

154 e issues, in the present study we report the solid-phase synthesis of lanthionine-bridged analogues o

155 This manuscript describes the automated, solid-phase synthesis of mixed backbone oligodeoxyribonu

156 This Article describes the automated solid-phase synthesis of mixed-backbone oligodeoxynucleo

157 methylcytidine (hm(5)rC) phosphoramidite for solid-phase synthesis of modified RNA oligonucleotides.

158 We report the solid-phase synthesis of N,N'-di(acylamino)-2,5-diketopi

159 anidine protection group greatly facilitates solid-phase synthesis of N,N'-substituted guanidine comp

160 amino acids and demonstrate their use in the solid-phase synthesis of N-amino peptide derivatives.

161 The discovery, structure elucidation, and solid-phase synthesis of namalide, a marine natural prod

162 ucleosides for potential applications in the solid-phase synthesis of native RNA sequences.

163 An efficient approach for the parallel solid-phase synthesis of novel heterocyclic azoniaspiro

164 Here, we report an efficient solid-phase synthesis of novel MPs by trapping a reversi

165 When employing phosphoramidites 1a-d in the solid-phase synthesis of oligonucleoside phosphorothioat

166 A method for the solid-phase synthesis of oligonucleotides containing C2-

167 ion of several of these phosphoramidites for solid-phase synthesis of oligoribonucleotides containing

168 nmasking of a single hydroxyl group precedes solid-phase synthesis of one arm of the cross-linked DNA

169 e of Fmoc and Alloc protecting groups during solid-phase synthesis of PAAs with backbones differing i

170 ic images of resin particles employed in the solid-phase synthesis of peptide combinatorial libraries

171 he tert-butyl group has so far prevented the solid-phase synthesis of peptoid oligomers incorporating

172 One challenge in automated solid-phase synthesis of phosphorothioate-containing RNA

173 re in such a system is reminiscent of modern solid-phase synthesis of polypeptides and polynucleotide

174 esis of NiN2S2 metalloligands, including the solid-phase synthesis of resin-bound Ni(CGC)2-, and sulf

175 ic modifications are typically introduced by solid-phase synthesis of RNA oligonucleotides using nucl

176 By combining solid-phase synthesis of sequence-defined glycooligomers

177 lness of this approach is exemplified by the solid-phase synthesis of some derivatives of the natural

178 A divergent solid-phase synthesis of stable-isotope-labeled AHLs sui

179 The synthesis consisted of two key steps: a solid-phase synthesis of the cyclic, 47-mer V3 domain pe

180 The solid-phase synthesis of the deglycobleomycin library pr

181 Finally, solid-phase synthesis of the desired glycopeptides direc

182 l can be divided into three major parts: (i) solid-phase synthesis of the fluorescence-labeled HyCoSu

183 This first solid-phase synthesis of the Leishmania cap provided rap

184 Solid-phase synthesis of the trithiazole deglycoBLM A(5)

185 hat do and do not cyclize efficiently during solid-phase synthesis of thioether macrocycles without t

186 amidite monomers, which are required for the solid-phase synthesis of two chimeric RNA sequences (20-

187 This entailed the solid-phase synthesis of two enkephalin precursor chains

188 ynthesis of IGF-1 analogs, which entails the solid-phase synthesis of two IGF-1 precursor chains that

189 of alpha- and beta-Nsmoc amino acids to the solid-phase synthesis of two model peptides was examined

190 as suitable building blocks for the solution/solid-phase synthesis of two model tripeptides with the

191 We present here the solid-phase synthesis of two novel classes of phosphopep

192 et Reactor as a physical method to implement solid-phase synthesis on individual functionalized micro

193 polymers play many roles, from supports for solid-phase synthesis or catalysis to media for separati

194 ed to larger polypeptides produced by either solid-phase synthesis or recombinant techniques and give

195 The solid-phase synthesis plays a critical role in the succe

196 an frequently be synthesized using efficient solid phase synthesis procedures similar to peptide synt

197 he non-native nucleobase was incorporated by solid-phase synthesis produced electrocatalytic signals

198 lel beta-sheet mimics, we developed a facile solid phase synthesis protocol.

199 A solid-phase synthesis protocol for the preparation of pr

200 mimetics obtained by a general monomer-based solid-phase synthesis protocol.

201 Solid-phase synthesis provided 13 analogues, which were

202 The solid-phase synthesis relied on assembly from monosaccha

203 Traceless solid-phase synthesis represents an ultimate sophisticat

204 Solid-phase synthesis serves as an interesting strategy

205 An automated method for the solid-phase synthesis (SPS) of REMO of any specified seq

206 Two approaches have been developed: (i) solid-phase synthesis starting from amino acids immobili

207 d conjugates were constructed stepwise using solid-phase synthesis starting from immobilized primary

208 ligodeoxyribonucleotides were prepared via a solid phase synthesis strategy.

209 Fmoc (9-fluorenylmethoxycarbonyl) protected solid phase synthesis strategy.

210 Herein, the solid-phase synthesis strategy is developed to precisely

211 te oligodeoxynucleotides were prepared via a solid-phase synthesis strategy.

212 yco-assembly efficiencies than the automated solid-phase synthesis strategy.

213 The process has been optimized for automated solid-phase synthesis, successfully producing a 20-unit

214 xyl groups were obtained using a photolabile solid-phase synthesis support (2) and a commercially ava

215 xynucleotide conjugates were prepared on the solid-phase synthesis support following selective unmask

216 '-alkylamines were obtained from photolabile solid-phase synthesis supports (1 and 4).

217 Solid-phase synthesis techniques were used to prepare de

218 sing 9-fluorenylmethoxycarbonyl (Fmoc)-based solid-phase synthesis techniques.

219 triester alkyl group dictates the success of solid-phase synthesis; tertiary alkyl groups are lost du

220 mino acid derivatives suitably protected for solid-phase synthesis that give rise to residues contain

221 complex carbohydrate mixture was obtained by solid-phase synthesis, the desired oligosaccharide conta

222 amino acid was readily generated for use in solid phase synthesis to make peptides that can be funct

223 Here, we employ automated fast-flow solid-phase synthesis to access catalytically active ful

224 r were synthesized and employed in automated solid-phase synthesis to construct poly(phosphodiester a

225 Here, we used solid-phase synthesis to generate a new series of helica

226 hosphoramidite derivatives, and their use in solid-phase synthesis to yield chimeric OxT-DNA and OxT-

227 organic chemistry and cleavable linkers for solid phase synthesis, to more modern applications in dy

228 selected peptides LDIFSDF and LDIFSDFR, via solid-phase synthesis, to "mimic" the tightly held charg

229 We here report a general solid-phase synthesis toward SH chemical probes, which w

230 Solid-phase synthesis underpins many advances in synthet

231 [D-Pro10]Dyn A-(2-11) was prepared by solid phase synthesis using Fmoc-protected amino acids,

232 ing phosphorodithioate linkage via automated solid-phase synthesis using 5'-O-DMTr-2'-O-TBS-ribonucle

233 introduced into peptides ribosomally or via solid-phase synthesis using alpha-hydroxyphenylselenocys

234 and optimized to allow efficient and facile solid-phase synthesis using phosphoramidite chemistry.

235 1 was also prepared by solid-phase synthesis, using the acid-sensitive 2-chloro

236 Solid-phase synthesis was employed to prepare linear ant

237 Translation to solid-phase synthesis was facilitated by the use of a te

238 Solid-phase synthesis was used to generate benzylamides

239 MN10021, prepared by solid-phase synthesis, was dimerized through a naturally

240 ticularly those that need to be generated by solid phase synthesis with chemical addition of end-bloc

241 nanoparticles, prepared in aqueous media by solid phase synthesis with immobilised L-thyroxine, gluc

242 through the triazole linker was achieved by solid phase synthesis with the global click reaction.

243 through the triazole linker was achieved by solid phase synthesis with the global click reaction.

244 NC-1059 peptide was synthesized by solid-phase synthesis with 9-fluorenylmethoxycarbonyl ch

245 horamidite and incorporated it into DNAs via solid-phase synthesis with a coupling yield over 97%.

246 ligosaccharides in solution and by automated solid-phase synthesis with glycosyl phosphate building b

247 Solid-phase synthesis with N(alpha)-9-fluorenylmethyloxy

248 uidics to address a long-standing problem in solid-phase synthesis with potentially wide-ranging impl

249 defined poly/oligo(amidoamines) (PAAs) using solid-phase synthesis with the capability of introducing

250 pects the favorable purification features of solid-phase synthesis with the favorable reaction, ident