ライフサイエンスコーパス: PAN

1 PAN also markedly increased glomerular and interstitial

2 PAN domain I contains many long loops that extend from t

3 PAN nephrosis increased the protein levels of JAM-A, occ

4 PAN proteins become polarized prior to asymmetric cell d

5 PAN RNA expression decreased expression of gamma interfe

6 PAN RNA interacts with specific demethylases and physica

7 PAN's ATPase activity was stimulated similarly by globul

8 PAN, a yeast poly(A) nuclease, plays an important nuclea

9 PAN-811 disrupts neurotoxic pathways by at least two mod

10 PANs colocalize in SMCs, and both PAN1 and PAN2 promote

11 demonstrate that Mta also binds to the nut-1/PAN promoter DNA in vitro and in infected cells.

12 cular, Mta robustly transactivates the nut-1/PAN promoter independently of Rta in 293 and Akata-31 ce

13 ifferent levels and included the genes nut-1/PAN, ORF57/Mta, ORF56/Primase, K2/viral interleukin-6 (v

14 seen for 11S activators and inferred for 19S/PAN activators and indicates a unified model for gate op

15 of 261551 CABG, 573072 PCI, 35104 AAA, 4931 PAN, and 2473 ESO procedures were selected for analysis.

16 This extreme adaptation of a PAN domain reveals how malaria parasites have introduced

17 complication rates following CABG, PCI, AAA, PAN, and ESO were 26.45%, 6.74%, 23.81%, 39.28%, and 46.

18 esponding numbers of hospitals for PCI, AAA, PAN, and ESO were 714, 1207, 758, and 555 respectively.

19 primary procedure codes for CABG, PCI, AAA, PAN, and ESO were selected.

20 nd support the hypothesis that RTA activates PAN RNA expression through direct binding to DNA.

21 n for the unrelated ATP-dependent activators PAN and PA700.

22 l required PAN's ATPase activity, even after PAN-catalyzed unfolding.

23 Our data indicate that after PAN injury, VEGF promotes podocyte survival by triggerin

24 06 inhibit proteinuria by protecting against PAN-induced podocyte injury, which may be associated wit

25 Hsp27 provided dramatic protection against PAN-induced microfilament disruption in sense > vector >

26 Antibodies raised against PAN-1 reveal it is present both in the soma and the germ

27 Also, PAN RNA expression mediates a decrease in the production

28 Although PAN has six identical subunits, it binds ATPs in pairs,

29 rats treated with puromycin aminonucleoside (PAN) and from patients with focal segmental glomeruloscl

30 of MCD induced by puromycin aminonucleoside (PAN) and in vitro cultured mouse podocytes.

31 on in response to puromycin aminonucleoside (PAN) nephrosis.

32 nous injection of puromycin aminonucleoside (PAN), whereas control rats received physiologic saline v

33 ucture in chronic puromycin aminonucleoside (PAN)-induced nephropathy in rats were evaluated in vivo.

34 ry-inducing agent puromycin aminonucleoside (PAN).

35 llowing 3 of the 5 procedures (PCI, AAA, and PAN) and specifically for significantly lower odds for r

36 atory complications following CABG, AAA, and PAN, digestive complications following PAN, hemorrhage/h

37 Two established activators, Blm10 and PAN/19S, induce gate opening by binding to the pockets b

38 f podocytes to resist PAN-induced injury and PAN-induced albumin leakage.

39 e-exon ORFs (K4, K4.1, K4.2, K5, K6, K7, and PAN), but previous computer analyses have failed to iden

40 RF57 enhanced the nuclear levels of mRNA and PAN, a nuclear KSHV RNA, and the activity of various ORF

41 These findings suggest that PA26 and PAN/19S C-terminal residues bind superimposably and that

42 d, our understanding of binding partners and PAN RNA binding motifs remains incomplete.

43 In both FSGS patients and PAN-treated rats, miR-30s were downregulated in podocyte

44 lowing PCI, and septicemia following PCI and PAN when compared with low-volume hospitals (P < 0.05).

45 he ratio of the different 20S proteasome and PAN proteins to modulate the structure and ultimately th

46 can contribute to the formation of ozone and PANs-type compounds in the troposphere.

47 ATPases from eukaryotes (RPTs) and archaea (PAN) bind ATP with high affinity at neighbouring subunit

48 The performance of these high-surface-area PANs is evaluated by monitoring the electrophysiological

49 tron-less polyadenylated transcripts such as PAN RNA and beta-globin cRNA exhibit two-component expon

50 s I+II consists of two intimately associated PAN domains.

51 Projected changes in atmospheric PAN reflect a balance between an increased supply of per

52 f the archaeal proteasome regulatory ATPase, PAN.

53 th 2-OHE significantly (P < 0.05) attenuated PAN-induced decrease in glomerular filtration, reduced p

54 ains seven AAA proteins, five of which, both PAN proteins, two out of three CDC48 proteins, and the A

55 tubular damage and podocyte loss induced by PAN nephrosis.

56 nt neuroprotective compounds, represented by PAN-811, that effectively block both ischemic and hypoxi

57 of modification, UV-dried thin PAN-over C18-PAN provided the best results.

58 viously developed C18-polyacrylonitrile (C18-PAN) thin-film solid-phase microextraction (SPME) coatin

59 lyadenylated, exclusively nuclear RNA called PAN that is highly expressed in lytically infected cells

60 Childhood PAN is a severe inflammatory disease of insidious onset

61 treatment, and outcome of systemic childhood PAN and to identify predictors of relapse.

62 odeled and measured vertical profiles of CO, PAN, O(3), and (7)Be indicate that this uncertainty is l

63 ration was performed by ALD onto TiO2 coated PAN nanofibers.

64 The archaeal ATPase complex PAN, the homolog of the eukaryotic 26S proteasome-regula

65 d, in archaea, by a homologous ring complex, PAN.

66 e responses, we investigated if constitutive PAN RNA expression could affect other genes involved in

67 The deduced PAN proteins were 60% identical with Walker A and B moti

68 n of a member of the PYRIN and NACHT domain (PAN) family, PAN1 (also known as NALP2 and PYPAF2).

69 RNAi) is variably effective in knocking down PAN-1 protein and results in adult progeny that display

70 The Drosophila PAN GU (PNG) kinase complex regulates the developmental

71 uring lytic replication from the viral early PAN promoter.

72 The element, PAN-ENE (PAN RNA expression and nuclear retention elemen

73 By electron microscopy (EM), PAN appears as a two-ring structure, capping the 20S, an

74 romoters of two other KSHV DE genes encoding PAN (polyadenylated nuclear) RNA and MTA (ORF57), which

75 The element, PAN-ENE (PAN RNA expression and nuclear retention element), incre

76 A-Seq analysis using cell lines that express PAN RNA shows that transcription involving the expressio

77 , and PAN, digestive complications following PAN, hemorrhage/hematoma complications following PCI, an

78 tween subcomplexes I and II is essential for PAN function, implying functional and perhaps mechanical

79 and structural motifs that are essential for PAN function.

80 e show that these residues are essential for PAN to associate with the 20S and open its gated channel

81 Hospital volume levels for PAN or ESO did not influence outcomes following CABG, PC

82 , and AAA did not influence the outcomes for PAN or ESO.

83 as to identify putative binding partners for PAN RNA in an effort to elucidate a possible function fo

84 symmetric division model and is required for PAN polarization.

85 degradation or eliminate the requirement for PAN and ATP.

86 These data support a role for PAN RNA as a major global regulator of viral and cellula

87 -4) promoter, strongly suggesting a role for PAN RNA in immune modulation.

88 Seven-residue or longer peptides from PAN's C terminus containing the HbYX motif also bind to

89 signaling, thereby protecting podocytes from PAN-induced injury.

90 The net effect is a general PAN increase in fall through spring, and a weak decrease

91 In the germline, PAN-1 uniquely localizes to P granules from the first la

92 only four nucleotides are bound to hexameric PAN.

93 ic-balance particle-poly(acrylonitrile) (HLB-PAN) slurry.

94 9S ATPases or in archaea with the homologous PAN ATPase complex.

95 ase complex and in archaea by the homologous PAN ATPase ring complex.

96 creasingly efficient at stabilizing hydrated PAN.

97 A Bioconductor package implementing PAN is freely available online at http://bioconductor.or

98 In PAN-treated mouse podocytes, pre-incubation with CsA and

99 We hypothesize that enhancements in PAN due to wildfire emissions may lead to regional enhan

100 show that two conserved arginine fingers in PAN located at the subunit interface work together as a

101 ed (-CN[triple bond]N:) functional groups in PAN during electrospinning, leading to a strong interfac

102 ssociated with ATP binding and hydrolysis in PAN based on the x-ray structures of the homologous AAA

103 and specifically branched actin networks, in PAN polarization and asymmetric cell division.

104 al long noncoding RNA (lncRNA), and increase PAN stability.

105 NO(x) export efficiency driven by increased PAN production and transport.

106 (x) export from North America, the increased PAN formation associated with E85 fuel use thus acts to

107 ost importantly, ORF 50(1-490)+VP can induce PAN RNA and K12 transcripts in transfected cells.

108 Treatment with CsA and FK506 also inhibited PAN-induced podocytes apoptosis, which was associated wi

109 tudies revealed that CsA and FK506 inhibited PAN-induced p38 and JNK signaling, thereby protecting po

110 number nucleoprotein interactions involving PAN have been implicated, our understanding of binding p

111 xplained by surface accumulation of zinc ion-PAN complex on the microsphere/sample solution interface

112 In summary, ALT joins PAN/nut1/T1.1 as a bona fide lncRNA of KSHV with potenti

113 In rats with one proteinuric kidney (PAN-treated) and one normal kidney (transplanted from a

114 Retention is also seen in cells lacking PAN, which Pab1 is thought to recruit and which may be r

115 ndeed, Thermoplasma acidophilum, which lacks PAN, encodes one CDC48 protein that interacts with the 2

116 opose that similar dual determinants mediate PAN-20S interactions and Rpt(1-6)-20S interactions in th

117 d thereby indirectly inhibits ORF57-mediated PAN accumulation.

118 First, a continuous mesoporous PAN/CNT based 3D monolith was established by using a tem

119 Treatment of sense cells with 5.0 microg/ml PAN resulted in increased cell survival and cell area wh

120 hsp27 content increased after 1.25 microg/ml PAN treatment and decreased after 5.0 microg/ml treatmen

121 ense cells were unaffected by 1.25 microg/ml PAN treatment whereas antisense cells showed decreases o

122 tigen (CSA-1-Ab) was immobilized on modified PAN (mPAN) fibers using covalent immobilization via amin

123 ORF57 have opposing functions in modulating PAN steady-state accumulation.

124 discovered mammalian CATERPILLER (NOD, NALP, PAN) family of proteins share similarities with the NBD-

125 (SFODME) using 1-(2-Pyridylazo)-2-naphthol (PAN) as a chelating reagent and detection by electrother

126 r obtained uses 1-(2-pyridylazo)-2-naphthol (PAN) as analyte sensitive receptor and pyrene as optical

127 uncture needles, porous acupuncture needles (PANs) with hierarchical micro/nano-scale conical pores u

128 In puromycin aminonucleoside nephrosis (PAN), GIV expression increased, GIV was phosphorylated b

129 We present posterior association networks (PANs) to predict functional interactions between genes e

130 The activity of phasically active neurons (PANs) in the striatum covaried with two classes of infor

131 ere are precursors to peroxy acetyl nitrate (PAN), affect the tropospheric ozone budget, and in the r

132 an important role for peroxyacetyl nitrate (PAN) in producing O3 during transport from the Californi

133 by an increase in the peroxyacetyl nitrate (PAN) to NO(y) ratio.

134 for the hydrolysis of peroxyacetyl nitrate (PAN), and experimental attempts to detect products of th

135 tors, known as PYD-Nod-like receptors (NLR), PAN, PYPAF, NALP, Nod, and Caterpiller proteins, to the

136 Polyarteritis nodosa (PAN) is a rare disease of childhood.

137 s developed mesenteric polyarteritis-nodosa (PAN)-like vasculitis in their life span, some as early a

138 This novel noncoding PAN RNA is the most abundant lytic transcript of KSHV; t

139 kappa protein binds ORF57 and vMIP-1 but not PAN or K12 promoters.

140 ls, the level of expression of ORF57 but not PAN RNA is repressed.

141 identified a primary cilium-autophagy-Nrf2 (PAN) control axis coupled to cell-cycle progression that

142 paralleled their ability to enhance nuclear PAN accumulation, suggesting that ORF57 may also act on

143 es the expression of polyadenylated nuclear (PAN) RNA (also known as T1.1 or nut-1) of KSHV.

144 o the KSHV noncoding polyadenylated nuclear (PAN) RNA by ORF57.

145 herpes virus (KSHV) polyadenylated nuclear (PAN) RNA facilitates lytic infection, modulating the cel

146 f the long noncoding-polyadenylated nuclear (PAN) RNA from Kaposi's sarcoma-associated herpesvirus is

147 core element of KSHV polyadenylated nuclear (PAN) RNA, a viral long noncoding RNA (lncRNA), and incre

148 clear noncoding RNA, polyadenylated nuclear (PAN) RNA, which contains an element that prevents its de

149 umulation of a viral polyadenylated nuclear (PAN) RNA.

150 is a negative regulator of poly(A) nuclease (PAN) activity and that Fir1p and Ref2p are, respectively

151 ing protein, Pab1, and the poly(A) nuclease, PAN, as important factors that couple 3' processing to e

152 volcanii proteasome-activating nucleotidase (PAN) genes (panA and panB).

153 encoding proteasome-activating nucleotidase (PAN) proteins closely related to the regulatory particle

154 Cdc48 or proteasome-activating nucleotidase (PAN) unfoldases.

155 mplex of proteasome-activating nucleotidase (PAN), is responsible for target protein recognition, fol

156 mplex of proteasome-activating nucleotidase (PAN).

157 In vivo, chronic administration of PAN (75 mg/kg + 5 x 20 mg/kg) over 12 wk induced severe

158 model of ischemic stroke, administration of PAN-811 i.c.v. 1 h after middle cerebral artery occlusio

159 he larval arrest and allows an assessment of PAN-1 function in the germline.

160 Key residues line the axial channel of PAN, defining the apparent pathway of substrate transloc

161 reaction mechanism for the decomposition of PAN is proposed.

162 eal proteasome: the CP, the ATPase domain of PAN, and a distal subcomplex that is likely the first to

163 The OB domains of PAN form a hexameric ring with a 13 A pore, which likely

164 Expression of PAN RNA in various cell types results in an enhanced gro

165 e calculations suggest that the formation of PAN hydrate complexes are energetically favorable and st

166 Subcomplex II of PAN, comprising the ATPase domain, associates with the C

167 We now show that the lack of PAN RNA expression results in the failure of the initiat

168 rease the nuclear abundance and half-life of PAN RNA but is not sufficient to promote its export.

169 Thus, while loss of PAN-1 in the soma inhibits molting, this report demonstr

170 vels and induces aberrant polyadenylation of PAN and thereby indirectly inhibits ORF57-mediated PAN a

171 eral arteriography suggested the presence of PAN in 96% of patients.

172 conservation suggests that the principles of PAN function are likely to apply to the proteasomal RP o

173 ressed in human cells binds the promoters of PAN and K12 but does not bind ORF57 or vMIP-1 promoters.

174 Pan3p, a positive regulator of PAN activity, interacts with Pab1p, thus providing subst

175 These findings demonstrate the robustness of PAN-based coatings applied on such polymeric substrate a

176 tic infection; however, to date, the role of PAN RNA in the virus life cycle is unknown.

177 oad framework for understanding the roles of PAN RNA in KSHV infection.

178 undertook a comparative study of the RREs of PAN RNA, ORF57, vIL-6, and Kpsn to understand how RTA re

179 relates with ORF57-mediated stabilization of PAN RNA, suggesting that REF/Aly promotes nuclear RNA st

180 n cloning ("DIVEC") screen for substrates of PAN GU kinase, which is crucial for S-M embryonic cell c

181 Exhaustive trypsin treatment of PAN generated five distinct fragments, two of which diff

182 Human trials of PAN-811 for an unrelated indication have established a f

183 ncture needles shows enhanced performance of PANs with significantly less pain sensation.

184 Many translational changes depended on PAN GU and Smaug, and these changes were largely attribu

185 and the elevated BP, and it had no effect on PAN-induced increase in plasma cholesterol and triglycer

186 inding sites of select KSHV gene products on PAN RNA were also identified in in vitro experiments.

187 biological contexts, we identified sites on PAN either protected from chemical modification by prote

188 values of the available actions, while other PANs may participate in evaluative updating by encoding

189 lyacrylonitrile (PAN) and silica@metal oxide@PAN core/shell particles were synthesized by emulsion po

190 ortic aneurysm repair (AAA), pancreatectomy (PAN), and esophagectomy (ESO) as primary procedures were

191 ortic aneurysm repair (AAA), pancreatectomy (PAN), and esophagectomy (ESO).

192 Upon association with the 20S particle, PAN stimulates gate opening.

193 at the bZIP transcription factor PERIANTHIA (PAN) plays a role in regulating stem cell fate by direct

194 mental validation, we identified PERIANTHIA (PAN) as an important molecular regulator of quiescent ce

195 of water-mediated decomposition of gas-phase PAN into acetic acid and peroxynitric acid.

196 In cultured podocytes, PAN or a miR-30 sponge increased TRPC6, PPP3CA, PPP3CB,

197 Polyacrylonitrile (PAN) contained carbon nanotubes (CNTs), being pre-disper

198 edure in which sulfur and polyacrylonitrile (PAN) are the only reactants, we create a family of sulfu

199 bon nanotubes (MWNTs) and polyacrylonitrile (PAN) were successfully developed using electrospinning.

200 e source of carbon, i.e., polyacrylonitrile (PAN), and a sacrificial block, i.e., poly(n-butyl acryla

201 Electrospun polyacrylonitrile (PAN) based carbon nanofibers (CNFs) have attracted inten

202 ayer onto the electrospun polyacrylonitrile (PAN) nanofibrous web and then platinum nanoparticles (Pt

203 lipophilic balanced (HLB)-polyacrylonitrile (PAN) coating on rounded and flat PBT pieces previously s

204 ility of surface modified polyacrylonitrile (PAN) fibers as a novel matrix of immunoassay for the det

205 re combined with powdered polyacrylonitrile (PAN) in different mass ratios (SnS33, SnS50, and SnS70;

206 es of monodisperse silica@polyacrylonitrile (PAN) and silica@metal oxide@PAN core/shell particles wer

207 After being mixed with polyacrylonitrile (PAN) and pyrolyzed, MPSPs can alloy with lithium, result

208 three functionalities of polyacrylonitrite (PAN) nanofibers: 1) a substrate for loading active mater

209 deionized water to form pellets of a porous PAN-chalcogel hybrid material.

210 ansduction of Neph1CD in podocytes prevented PAN-induced mislocalization of Neph1.

211 PE-mutational profiling (SHAPE-MaP) to probe PAN in its nuclear, cytoplasmic or viral environments or

212 The ENE protects PAN RNA from a rapid deadenylation-dependent decay pathw

213 omerular injury by adriamycin and puromycin (PAN).

214 These sponge-like MPSPs with pyrolyzed PAN (PPAN) can accommodate the large volume expansion as

215 a factor that appears to negatively regulate PAN.

216 In this short report, PAN-1, which previously has been found by others in scre

217 gradation of globular GFPssrA still required PAN's ATPase activity, even after PAN-catalyzed unfoldin

218 increased the ability of podocytes to resist PAN-induced injury and PAN-induced albumin leakage.

219 c KSHV expresses polyadenylated nuclear RNA (PAN RNA), a long noncoding RNA (lncRNA).

220 SHV) expresses a polyadenylated nuclear RNA (PAN RNA).

221 t referred to as polyadenylated nuclear RNA (PAN RNA).

222 directly to the polyadenylated nuclear RNA (PAN) RRE motif, failed to bind to the RAP RRE and interf

223 zenesulfonic acid/polyacrylonitrile (C18/SCX/PAN) in order to assess the new prototype versus the exi

224 Shenmen (HT7) points in Wistar rats, showing PANs to be more effective in controlling electrophysiolo

225 nct functions mediated by the striatum: some PANs may participate in choice by encoding the values of

226 a region outside the 9-nt core to stimulate PAN expression, does not interact or even colocalize wit

227 ytic transcript of KSHV; therefore, studying PAN RNA expression serves as a model system for understa

228 only reactants, we create a family of sulfur/PAN (SPAN) nanocomposites in which sulfur is maintained

229 noprecipitation (ChIP) assays confirmed that PAN RNA interacted with these factors in the infected ce

230 ibits molting, this report demonstrates that PAN-1 is also a P-granule component that is essential fo

231 We report that PAN contains a novel post-transcriptional element essent

232 We report that PAN RNA promotes LANA-episome disassociation through an

233 interaction with demethylases, we show that PAN RNA binds to protein components of Polycomb repressi

234 in BCBL-1 cell nuclear extract to show that PAN RNA interacts with several virus- and host cell-enco

235 A luciferase reporter assay showed that PAN RNA expression interfered with the ability of IRF4/P

236 These data strongly suggest that PAN RNA interacts with viral and cellular proteins and c

237 We speculate that PANs may function in all contexts to regulate polarized

238 The PAN GU (PNG) kinase positively promotes translation of C

239 The PAN study is a noninterventional study enrolling patient

240 The PAN-1 predicted protein contains multiple leucine-rich r

241 The PAN-ENE does not concomitantly increase the production o

242 The PAN-induced Neph1 phosphorylation was significantly redu

243 we studied archaeal 20S proteasomes and the PAN (proteasome-activating nucleotidase) regulatory comp

244 e molecular interactions between RTA and the PAN promoter, an extensive mutagenesis study on the pPAN

245 of specific interactions between RTA and the PAN promoter.

246 classes of promoters in reporter assays; the PAN and K12 promoters cannot be activated, while the ORF

247 d for ATP-dependent protein breakdown by the PAN-20S proteasome complex (K(m) approximately 300-500 m

248 In contrast, the PAN proteins were not essential based on the robust grow

249 e high nitrogen content originating from the PAN precursor.

250 quence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein

251 obular proteins requires ATP hydrolysis, the PAN-20S complex with ATPgammaS translocates and degrades

252 o intronless constructs, since inserting the PAN-ENE into a spliced beta-globin construct has no effe

253 A recombinant BACmid lacking the PAN RNA locus fails to express K-Rta and does not produc

254 pment of two new structure-based motifs (the PAN and INTERFACE motifs).

255 In the case of the PAN and 19S activators, a penultimate tyrosine/phenylala

256 sitivity to monitor the conformations of the PAN ATPase from Methanococcus jannischii.

257 nanofibers was much higher than that of the PAN polymer crystal matrix as detected by two-dimensiona

258 s to the RTA-responsive element (RRE) of the PAN promoter.

259 vitro and RTA transactivation in vivo of the PAN promoter.

260 The activities of the PAN-ENE are specific to intronless constructs, since ins

261 rs can override the nuclear retention of the PAN-ENE, supporting a mechanism whereby the PAN-ENE bloc

262 l proteasome-activating nucleotidases of the PAN/ARC/Rpt group, which are absent in major archaeal li

263 strating the advantageous performance of the PAN/CNT based 3D-NDP-ACMs.

264 The electrical conductivity of the PAN/MWNT composite nanofibers containing 20 wt % nanotub

265 The TiO2 protective layer on the PAN polymeric nanofibers was presented as an effective r

266 nal loop that hybridizes to and protects the PAN RNA poly(A) tail.

267 n intramolecular RNA clamp, sequestering the PAN poly(A) tail and preventing the initiation of RNA de

268 F57 associated with DNA corresponding to the PAN RNA transcribed region, a known posttranscriptional

269 ATP binding to the PAN-ATPase complex in Archaea or the homologous 19 S pro

270 Unlike the PAN ENE, the U-rich internal loops of both predicted cel

271 PAN-ENE, supporting a mechanism whereby the PAN-ENE blocks assembly of an export-competent mRNP.

272 g all methods of modification, UV-dried thin PAN-over C18-PAN provided the best results.

273 The free-standing and flexible Pt-NP/TiO2-PAN nanofibrous web showed the enhancive reduction of 4-

274 Even after multiple usage, the Pt-NP/TiO2-PAN nanofibrous webs were stable with the flexible natur

275 e that the barrier for one water addition to PAN is large.

276 r supporting this idea, tethering REF/Aly to PAN RNA is sufficient to increase the nuclear abundance

277 teolysis, we studied how nucleotides bind to PAN.

278 and electrochemical properties comparable to PAN-type, T-650, carbon fiber microelectrodes using back

279 l residues, including those corresponding to PAN.

280 ; in addition, these cells were resistant to PAN-induced cytoskeletal damage.

281 ogenous Neph1 at the membrane in response to PAN-induced injury.

282 ted on with massive GI bleeding secondary to PAN, treated with successful percutaneous transcatheter

283 tes but were significantly more sensitive to PAN-induced injury, produced more prostaglandin E(2) and

284 The suppressive effect of PABPC1 specific to PAN expression is alleviated by small interfering RNA kn

285 Subunits of the unrelated PAN/19S activators bind with their C termini in the same

286 target of viral ORF57 to directly upregulate PAN accumulation during viral lytic infection, and the a

287 of cocaine induced locomotor activity using PANs and thick acupuncture needles shows enhanced perfor

288 Action-value PANs were correlated with value estimates for one of the

289 Chosen-value PANs were correlated with the value of the action that h

290 eterologous lytic promoters (e.g., the viral PAN gene).

291 constructs using a newly developed in vitro PAN model system.

292 Using a zebrafish in vivo PAN and adriamycin injury models, we further demonstrate

293 When PAN binds two ATPgammaS molecules or two ATPgammaS plus

294 employed an in vitro affinity protocol where PAN RNA was used as bait for factors present in BCBL-1 c

295 tive medical records review of children with PAN fulfilling the European League Against Rheumatism (E

296 Sixty-nine children with PAN were identified; 55% were male, and their median age

297 in class structure, and JAK3 in complex with PAN-JAK inhibitors CP-690550 ((3R,4R)-3-[4-methyl-3-[N-m

298 he transduced cells following treatment with PAN, indicating that transduction of Neph1CD in podocyte

299 n cultured podocytes prior to treatment with PAN.

300 pid degradation of unfolded proteins without PAN; however, degradation of globular GFPssrA still requ