ライフサイエンスコーパス: deprotect

1 urther cross coupling reactions, and readily deprotected.

2 l pyruvates were formed and finally globally deprotected.

3 the bicyclic ring system and can be readily deprotected.

4 ic external protein segments become strongly deprotected.

5 ed to a near-UV laser is used to selectively deprotect 2-nitrophenylpropyloxycarbonyl (NPPOC)-protect

6 , while trifluoroacetic acid was required to deprotect 2e and afford 1.

7 Compound 36 was converted to the fully deprotected 6-azido-GlcN (37) and 2,6-diaminoglucose (38

8 Once the ligand is deprotected, a conformational change generates a similar

9 les, the present method was also extended to deprotect acetonides obtained from 1,2-, and 1,3-termina

10 re reacted with ethylenediamine, whereas the deprotected alkyne functions of 2 were self-reacted by E

11 amolecular displacement of a mesylate by the deprotected amine.

12 The synthesis was performed via 3a and the deprotected amines 5a, 13, and 19, including three repea

13 Each of the deprotected amines was isolated without chromatography u

14 liminates the cumbersome steps of protecting/deprotecting amino or hydroxy groups.

15 nexpectedly, cohered sister telomeres become deprotected and are inappropriately fused.

16 These compounds were subsequently deprotected and converted into the 2'-O-[2-[(methyleneam

17 Such microbeads that can be sequentially deprotected and converted to NO release particles via in

18 The silanyloxy esters were efficiently deprotected and coupled to the C2-C10 amino acid fragmen

19 obtained from the N-benzylation reaction was deprotected and coupled with diethyl l-glutamate followe

20 4, the ester obtained from the reaction was deprotected and coupled with diethyl L-glutamate followe

21 The esters obtained from the reaction were deprotected and coupled with diethyl-l-glutamate followe

22 midt conditions afforded a chalcone that was deprotected and cyclized in the presence of sodium aceta

23 -protected beta-amidoalcohols can be in situ deprotected and dehydrated to give 2-oxazolines in good

24 are associated with increased frequencies of deprotected and fragile telomeres.

25 osphine-substituted boronate esters could be deprotected and isolated in pure form.

26 Five examples were then deprotected and screened for their efficacy as enzyme in

27 urther modification of the termini gives the deprotected and stannylated compounds RC4-Fe(depe)2-C4-F

28 The unique surface sites can be deprotected and subjected to additional chemistries.

29 Compound 3a was deprotected and the resultant nucleoside used to prepare

30 The resulting phosphine-boranes were deprotected and used as reagents in the desymmetrizing a

31 Data suggest they are taken up, are deprotected, and are converted to a potent inhibitory fo

32 (8) or di-n-propyl (9), have been prepared, deprotected, and peripherally metalated with molybdocene

33 RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to thos

34 rom controlled-pore glass supports and fully deprotected by ammonia or methylamine under gas phase co

35 Each of the latter was globally deprotected by catalytic (Pd/C) hydrogenation/hydrogenol

36 protected segment at -107 to -99 that can be deprotected by coincubation with molar excess of a conse

37 The protected amides were then smoothly deprotected by heating with ethylenediamine derivatives,

38 ide, the prepared N-benzyl tetrazoles can be deprotected by hydrogenolysis to form the corresponding

39 6(II)-cyclic phosphates, which were globally deprotected by one-step catalytic (Pd/C) hydrogenation/h

40 he elaborated proteins could subsequently be deprotected by photolysis.

41 The Dma group is then deprotected by treatment with ammonia in methanol.

42 The ligated glycopeptides can be smoothly deprotected by UV irradiation.

43 nation pathways implicated in these fusions, deprotected chromosome ends will instead be eroded by nu

44 These groups can be deprotected cleanly and in high yield by irradiation fro

45 ; final acidic hydrolysis afforded the fully deprotected compounds as their TFA salts.

46 elected so that the antenna of the resulting deprotected compounds could be selectively extended by g

47 All of the deprotected compounds were screened for inhibition of HC

48 analogues 3 and 4, the ester precursors were deprotected, coupled with diethyl-L-glutamate, and sapon

49 After the metal ions were removed, the deprotected cysteines were then available to specificall

50 c chemistry that are heavily used to protect/deprotect different functionalities.

51 Capture of nucleobase- and phosphate-deprotected DNA sequences released from the synthesis su

52 tution on the thioxanthyl backbone were also deprotected efficiently with irradiation at 350 nm.

53 of their diverse stereochemical attributes, deprotected enyne analogues 5a, 6a, 9a, and 13 derived f

54 ormer-specific in either of its protected or deprotected forms, which is a unique property of this pr

55 The deprotected guanidines were subsequently regioselectivel

56 The deprotected guanidinium is configurationally stable unde

57 hich facilitated the generation of the fully deprotected HA decasaccharide.

58 The deprotected heptasaccharide 1 was coupled to a poly[N-(a

59 The protected substrates were deprotected in 1:1 water:acetonitrile with irradiation a

60 r or a protected form of ammonia that can be deprotected in a subsequent synthetic step.

61 HPLC, and each diastereomer was subsequently deprotected in acidic conditions.

62 ol , a triacylglycerol that was conveniently deprotected in ethanol with acrylic beads containing Can

63 nantioenriched allylic amide products can be deprotected in good yield to give enantioenriched allyli

64 benzylated N-sulfonylphosphoramidates may be deprotected in one step to give the free acids in quanti

65 succinimide products obtained can be easily deprotected in situ (if desired) to reveal the correspon

66 hiol and an additional disulfide linkage are deprotected in situ and trapped with an activated thioph

67 In alternate steps, the resin is deprotected in situ with TBAF and coupled to the 3-bromo

68 Aromatic acetates can be selectively deprotected in the presence of aliphatic acetates under

69 Completely deprotected, modified oligodeoxynucleotides were purifie

70 r RNA sample composed of 320-640 nmol of the deprotected nucleoside.

71 ces, depurination products, and incompletely deprotected oligonucleotides, linkage isomers may form d

72 ut not to identify and quantify incompletely deprotected oligonucleotides.

73 Furopyrimidine was deprotected or simultaneously converted into pyrrolopyri

74 This hydrosilyl directing group is readily deprotected or transformed to other functional groups af

75 hydrous hydrogen fluoride used to cleave and deprotect peptides after solid-phase peptide synthesis.

76 Globally deprotected peptides containing phenylselenocysteine can

77 eomer, and free homoallylamine affording the deprotected piperidine as single cis diastereomer.

78 On the basis of circular dichroism, the deprotected polymer possesses a regular secondary struct

79 Protected and deprotected polymers and model compounds are characteriz

80 The deprotected products are obtained in moderate to good ov

81 of the DMPBn ether giving the corresponding deprotected products in moderate to high yields.

82 nveniently and quantitatively converted into deprotected pyrrole-3-carboxylic esters 5 by a simple ba

83 and subsequent oxidation affords 31 and the deprotected quinone alcohol 34.

84 anethiol, is the easy extraction of both the deprotecting reagent and the byproduct 2-(diethylamino)e

85 orthogonal N-protecting groups, which can be deprotected selectively.

86 as established by constructing the partially deprotected single glycan chain containing glycopeptides

87 k on 17 leads directly to the isolation of N-deprotected substitution products (with concomitant deca

88 vancomycin aglycon (7), conducted on a fully deprotected substrate, are disclosed.

89 ctionalization was extensive, with the NPPOC-deprotected surfaces and aminopropylsiloxane control mat

90 n as TERF2) from mouse cells (TRF2(fl/-)) to deprotect telomeres, which, like double-strand breaks, a

91 was identified based on its association with deprotected telomeres and localized to sites of DNA dama

92 Imaging showed that deprotected telomeres are more mobile and sample larger

93 TM signaling, ATR signaling, NHEJ, and HR at deprotected telomeres can take place in the absence of o

94 Also unlike genomic breaks, we found that deprotected telomeres do not contribute to the G2/M chec

95 We found that, unlike genomic breaks, deprotected telomeres that are recognized as DNA damage

96 Deprotected telomeres undergo changes in chromatin struc

97 hromatin segments (PICh) technique to purify deprotected telomeres, PHF11 was enriched as cells mount

98 and recruit 53BP1 (also known as TP53BP1) to deprotected telomeres, the 3' telomeric overhang persist

99 arising from either critically shortened or deprotected telomeres.

100 species (ROS), Sir protein perturbation, or deprotected telomeres.

101 n modulating the structure and processing of deprotected telomeres.

102 joining recombination proteins for access to deprotected telomeres.

103 The coupling product 91 was deprotected (tert-butylhydrogen peroxide, trifluoroaceti

104 unctions without the need for an additive to deprotect the alkynyl carbon as endstanding anchor group

105 from deprotonation in the free enzyme while deprotecting the catalytic triad as a whole when in the

106 degraded at cancer sites by the enzyme, thus deprotecting the tumour and allowing prolonged antimetab

107 l organization of telomeres that have become deprotected through the deletion of the shelterin compon

108 ed version of 2-thioglyceraldehyde 13 can be deprotected to a useful form of this aldehyde.

109 lly, the TMS-acetylene unit has been cleanly deprotected to afford a terminal alkyne in the presence

110 lenes can be cyclized to 2-oxazolidinones or deprotected to afford the free amines which can be cycli

111 ear tetrabenzyl-protected trihydroxamate was deprotected to afford the natural product Danoxamine.

112 ated, phospholipidated, and finally globally deprotected to afford the target molecule.

113 sible aldol adducts, which were oxidized and deprotected to complete the synthesis of (-)-berkelic ac

114 accharides have been partially or completely deprotected to create 29 more structures to further incr

115 ed to 6-(het)aryl-deazapurine derivatives or deprotected to free phosphonic acids.

116 d linked to Asn, the carbohydrate moiety was deprotected to give 12.

117 rivatives 28 and 29 which were separated and deprotected to give 14 and 16.

118 ly reduced using sodium borohydride and then deprotected to give allo- and epi-inositol in good yield

119 ation all isomers 24a-24d were separated and deprotected to give aminospiropentane hydrochlorides 25a

120 The MEDAM imines can be deprotected to give N-H aziridines in all cases except f

121 These intermediates were deprotected to give the 6'-chloro 3a, 6'-bromo 3b, and 6

122 ished in a facile manner, which was globally deprotected to give the Fuc-GM(1) glycoside 1.

123 yclic derivatives 11a-d and 19 produced were deprotected to give the new kainoid amino acids 6a-d and

124 Finally, the GPI-anchored peptide was deprotected to give the target molecule 1.

125 rnish silylated hydroperoxides, which can be deprotected to homologated hydroperoxides.

126 The carbomethoxy groups were deprotected to obtain carboxylic groups used to immobili

127 henium metal was subsequently photolytically deprotected to obtain the macrocycle 1.

128 e rearranged with strong base, oxidized, and deprotected to the desired o-carboxybenzophenones.

129 ntrol, forming beta-imino amides that can be deprotected to the primary beta-amino amide or reduced t

130 atives, which were fluorinated with DAST and deprotected to yield 2,5, 6-trichloro-1-(2-deoxy-2-fluor

131 hydantoins may be hydrolyzed and oxidatively deprotected to yield hydantoins and unsaturated alpha-qu

132 After pyrophosphorylation, the material is deprotected to yield N(6)-(2-aminoethyl)-2'-deoxyadenosi

133 er separation, the beta-isomers were further deprotected to yield the target nucleosides.

134 upports because of its ability to cleave and deprotect under mild conditions in standard reagents.

135 was circumvented when oligonucleotides were deprotected under mild conditions (aq ammonia-EtOH, rt).

136 phyrins and multiporphyrin arrays yet can be deprotected under mild conditions (TMS-Cl/TEA or TMS-Br/

137 ates during the synthesis and can be cleanly deprotected under mild conditions.

138 Acetals and ketals are readily deprotected under neutral conditions in the presence of

139 otected pyrrolidines, which could be readily deprotected under standard conditions.

140 uflonyl-1-arylisoindolinones, which can be N-deprotected using samarium iodide to generate the free 1

141 charide isolated in 47% yield, which is then deprotected using standard procedures to provide fucosyl

142 -dioxides) were synthesized and subsequently deprotected using trifluoroacetic acid.

143 nvolving pinacol boronate esters, which were deprotected via a two-stage procedure involving intermed

144 )-8'-(trimethylsilyl)enynes 8a,b, which were deprotected with aqueous trifluoroacetic acid to give th

145 The acid labile carbamate 2d was deprotected with HCl/AcOH to provide 1, while trifluoroa

146 6 with acid chloride 38d gave 39d, which was deprotected with TFA and then mild base to give 8 in 45%

147 ligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C i