ライフサイエンスコーパス: ds

1 oligonucleotide and by a consensus cold Sp-1 ds oligonucleotide, indicating specific Sp-1 binding.

2 Double-stranded miR-140 (ds-miR-140) was transfected into chondrocytes to analyze

3 A threshold of at least 34% ds/total DNA provided specificity of 98.7% with a 90.5%

4 e identified from ants, and detection of 3,5-ds pyrrolizidine 251O in A. grandidieri represents the f

5 A ds DNA having the central tetranucleotide 5'-d(ACGT) pro

6 CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary str

7 rands of dsDNA, creating a nick instead of a ds break.

8 from total RNA by immunoprecipitation with a ds-RNA specific antibody.

9 etect double stranded deoxyribonucleic acid (ds-DNA)/drug interaction.

10 ctors demonstrated rapid formation of active ds-linear genomes that persisted stably as concatamers o

11 id not recognize the synthetic MDA5 agonist/(ds)RNA mimic polyinosinic-polycytidylic acid.

12 und to depend upon buffer concentration, and ds-DNA length, demonstrating a dependence on the double

13 o three more ions when binding to pt-DNA and ds-DNA than when binding to ss-DNA.

14 itrosative guanine deamination in ds-DNA and ds-oligonucleotides.

15 le-stranded poly(dG-dC).(dG-dC) (GC-DNA) and ds poly(dA-dT).(dA-dT) (AT-DNA) were observed by atomic

16 ow that fj interacts genetically with ft and ds in planar polarity and proximodistal patterning.

17 rols and the production of high titer ss and ds DNA antibodies of the IgG subclass that are not norma

18 lexes to areas of the telomere where ss- and ds-DNA are in close proximity, such as the 3'-telomeric

19 capacitive features associated with ss- and ds-ON.

20 ith similar affinity as unmodified ssDNA and ds AP-DNA with lower affinity.

21 icant improvement in SLEDAI score, ANA, anti-ds DNA, complement, and carbon monoxide diffusion lung c

22 thralgia and fever did not relapse, and anti-ds DNA antibody returned to normal during a follow-up pe

23 ng irreversible height change of the arrayed ds[RNA-DNA], as measured by atomic force microscopy, pro

24 with a detection limit of 0.34 mug mL(-1) at ds-DNA modified PGE.

25 e data suggest that the two polymerases bind ds-DNA very differently, but that both bind pt-DNA and s

26 Aconitase binds to both ds- and ssDNA, with a preference for GC-containing seque

27 The orientation state of surface-bound ds-DNA was followed by monitoring the fluorescence from

28 he force-extension relationship of a 1298 bp ds-DNA molecule.

29 rization of ss-cDNA to double-stranded cDNA (ds-cDNA) by Phi29 polymerase.

30 ill be useful in vitro and in vivo to create ds breaks at specific sites and generate deletions.

31 The Drosophila genes fat (ft) and dachsous (ds) encode large atypical cadherins that collaborate to

32 dherin-encoding genes fat (ft) and dachsous (ds).

33 the Drosophila cell polarity gene dachsous (ds), that segregates with MVP in the family.

34 d to improved models for potential-dependent ds-DNA reorientation at electrode surfaces and will faci

35 ties in the mechanism of potential-dependent ds-DNA reorientation.

36 rences in substrate specificity of desulpho (ds)-Gl SOTs and to understand the reaction mechanism of

37 r knowledge, detection of 5,8-disubstituted (ds) indolizidine iso-217B in T. electrum represents the

38 particular type of intermolecular disulfide (ds) bond is formed in the capsid of a cytoplasmically re

39 e in levels of constraint as estimated by dN/ds ratios, with the NGF proregion showing the lowest deg

40 DNA ds breaks in recombining switch (S) regions, where CSR o

41 ion-induced cytidine deaminase initiates DNA ds break formation by deamination of cytosines in S regi

42 ng that HP1553 is required for repair of DNA ds breaks.

43 lgidus PCNA trimer with double-stranded DNA (ds DNA) using multi-nanosecond classical molecular dynam

44 nce (5'-GCTGGTGG-3') in double-stranded DNA (ds DNA), an event critical to the generation of the 3'-s

45 tor for the presence of double-stranded DNA (ds-DNA) and (2) hybridization response of a secondary si

46 orientation dynamics of double-stranded DNA (ds-DNA) attached to planar glassy carbon electrode (GCE)

47 Briefly, a double-stranded DNA (ds-DNA) containing the symmetric sequence of 5'-CCGG-3'

48 ion and denaturation of double-stranded DNA (ds-DNA) is opened up to evaluate the hyperthermia perfor

49 lation of most abundant double-stranded DNA (ds-DNA) motifs.

50 (pt-DNA), and blunt-end double-stranded DNA (ds-DNA) show that the binding selectivity pattern is sim

51 The ratio of double-stranded to total DNA (ds/total ratio) in the buccal samples was the only labor

52 ed (ss) 5'-flaps one nucleotide into duplex (ds) DNA.

53 This PCNA sequestration likely exposed ds-ssDNA junctions at replication forks for XPA binding.

54 and hRap1 are in a complex, its affinity for ds telomeric sequences is 2-fold higher than TRF2 alone

55 in turn severely decreased its affinity for ds-DNA.

56 The effect is specific for ds ligation, and LX/DNA binding is not influenced by the

57 /or intrinsic immunity that causes impaired (ds)RNA sensing, reduced IFN induction, and susceptibilit

58 ediate in nitrosative guanine deamination in ds-DNA and ds-oligonucleotides.

59 hat most biological DNA targets are found in ds form.

60 reas multiply Ku-bound DNA molecules inhibit ds ligation.

61 oxidized by [Os(bpy)2(PVP)10Cl](+) in intact ds-DNA to provide catalytic square wave voltammograms (S

62 Co(bpy)(3)(3+) binds more strongly to intact ds-DNA, and its SWV peaks at 0.04 V decreased as DNA was

63 rom viral uncoating is either converted into ds DNA efficiently or degraded by cellular DNA repair me

64 rtance of MDA-5 helicase as an intracellular ds-RNA sensor in astrocytes.

65 intricacy of extracellular and intracellular ds-RNA recognition in viral infections of the central ne

66 induced the expression of the intracellular ds-RNA sensor proteins, retinoic acid inducible gene I (

67 pproximately 20-fold less efficient than its ds activity, depending on the oligonucleotide employed.

68 We found that in low salt both K(ds) and K(ss) have a very weak salt dependence for gp32,

69 the non-cooperative association constants (K(ds)) to double-stranded DNA to determine K(ds) as a func

70 e the noncooperative association constants K(ds) to double-stranded DNA for gp32 and *I, a truncated

71 K(ds)) to double-stranded DNA to determine K(ds) as a function of salt concentration for gp32 and *I.

72 Excess AP-2 or NF-kappaB ds oligonucleotide had no effect on nuclear protein bind

73 adily separates the less mobile cross-linked ds DNA from the more mobile ss DNA products.

74 with BLM A5 and A2, however, CD-BLM mediates ds-DNA cleavage through cooperative binding of a second

75 und probe with methylated vs. non-methylated ds-DNA.

76 We developed tools for misexpressing ds and ft in vitro and in vivo, and have used these to t

77 proportion of duplex nucleic acids in mixed ds/ss nucleic acid solutions, demonstrating significant

78 the reconstituted domains on ss versus mixed ds-ss DNA approximate the activity of intact RAG1 in the

79 an silence gene expression as well as native ds-siRNA, suggesting that boranophosphate-modified ss-si

80 inities, RPA blocks/inhibits the ss, but not ds, AP endonuclease function of Ape1.

81 The addition of ds-DNA caused formation of ds-DNA/IDA complex and recove

82 Thus, a larger amount of ds-DNA remains on the electrode surface after the HpaII

83 approximately 5 d, and sufficient amounts of ds-cDNA can be obtained from single-cell RNA template fo

84 e voltammetric oxidation of guanine bases of ds-DNA in the outer layers.

85 increased linearly with the concentration of ds-DNA from 1.2 to 6.0 microM.

86 ults in dramatically increased efficiency of ds DNA photocleavage, the most therapeutically valuable

87 as prepared by electrochemical entrapment of ds-DNA and Au nanoparticles in the o-phenylenediamine ne

88 The addition of ds-DNA caused formation of ds-DNA/IDA complex and recovered the RTP signal of Mn-do

89 tion phenotypes suggest that the gradient of ds expression is necessary for correct PCP throughout th

90 4 alkylates residues in the minor groove of ds DNA, cross-linking with the same 5'-d(CG) sequence sp

91 The integration of ds-DNA with molecularly imprinted polymer sensors allowe

92 , fcc, and AlB2) due to the intercalation of ds-DNA linking NPs.

93 Uniform levels of ds drive normally oriented PCP and, in all but the most

94 ondensed regions were surrounded by loops of ds GC-DNA.

95 fically inserts itself between base pairs of ds-DNA and catalyzes the electrooxidation of AA.

96 d a buccal sample characteristic, a ratio of ds/total DNA <34%, which distinguished buccal DNA sample

97 and applied to measure the Raman spectrum of ds-DNA during force-extension.

98 NA but had little effect on the synthesis of ds RNA.

99 pared through the concentration variation of ds-DNA modified on the surface.

100 nic:polycytidylic acid signaling via TLR3 or ds break-DNA signaling via a cytosolic pathway).

101 de residues when it binds to single (ss) or (ds) double stranded molecules.

102 ysteine)/Fe3O4 nanoparticles-graphene oxide (ds-DNA/p(L-Cys)/Fe3O4 NPs-GO/CPE) for sensitive detectio

103 and show that it is sufficient to alter PCP, ds expression is permissive or redundant with other PCP

104 gh-resolution crystal structure of the plant ds-Gl SOT AtSOT18 in complex with 3'-phosphoadenosine 5'

105 d discrimination of double-stranded plasmid (ds-Pl) without the need for denaturation of the target p

106 plementary double-strand plasmid to form PNA/ds-Pl triplex structure is the principle of target plasm

107 1 region, which binds to ds-Pl and forms PNA/ds-Pl structure.

108 ve detection and determination of riboflavin-ds-DNA interaction.

109 NAi), double-stranded short interfering RNA (ds-siRNA) inhibits expression from complementary mRNAs.

110 s a cytosolic sensor of double-stranded RNA (ds)RNA including viral byproducts and intermediates.

111 esults in expression of double-stranded RNA (ds-RNA) molecules that trigger innate immune responses t

112 lts with the FTIR analysis of extracted RNA, ds-DNA, ss-cDNA and isolated nuclei, we verified that th

113 ferentially located at the 5'-end in several ds DNA-oligomers with a GGG sequence.

114 (32)P]-hairpin technology harboring a single ds cleavage site reveal a ss:ds ratio of 6.7 +/- 1.2:1 f

115 own that a Rep monomer bound to such a 3'-ss/ds DNA substrate is unable to unwind the DNA and that a

116 "closed" conformation when bound to a 3'-ss/ds DNA, similar to the orientation observed in the compl

117 rved in the complex of PcrA bound to a 3'-ss/ds DNA.

118 y when unwinding a DNA fork compared to a ss/ds DNA junction substrate.

119 to a 3'-single-stranded-double-stranded (ss/ds) DNA junction in solution, as well as the relative or

120 ognizing single-stranded/double-stranded (ss/ds) DNA junctions.

121 pattern similar to that observed with the ss/ds junction, consistent with disruption of the interacti

122 quired to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads t

123 educed for the forked DNA compared to the ss/ds junction.

124 ion of base pairing was observed with the ss/ds junction.

125 oiled plasmid relaxation assay revealed a ss:ds ratio of 2.8:1 for CD-BLM in comparison with 7.3:1 an

126 boring a single ds cleavage site reveal a ss:ds ratio of 6.7 +/- 1.2:1 for CD-BLM and 3.4:1 and 3.1 +

127 Cleavage studies measuring ss:ds ratios by two independent methods were carried out.

128 Intensive studies of double strand (ds) cleavage activity of Type IIP REases, which recogniz

129 ScMcm10 binds stably to both double strand (ds) DNA and single strand (ss) DNA.

130 n both single strand (ss) and double strand (ds) DNA.

131 ugated single-strand (ss) and double-strand (ds) 20-base oligonucleotides (ONs) immobilized on single

132 Double-strand (ds) breaks were observed at two sites: 8 bp upstream and

133 ccination, and development of double-strand (ds) DNA autoantibodies.

134 here pH-gated light-activated double-strand (ds) DNA cleavage is controlled by variations in electron

135 DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGC

136 We show that this double-strand (ds) RNA induces localized RNAi (Dicer and RITS) dependen

137 t searches for a homologous double stranded (ds) DNA and catalyzes the exchange of complementary base

138 ng single stranded (ss) and double stranded (ds) DNA, and, in addition, develop glomerulonephritis.

139 DNA when the target is in a double stranded (ds) form and compare the response to single stranded (ss

140 as been shown to respond to double stranded (ds) RNA, a replication intermediary for many viruses.

141 examined the involvement of double stranded (ds) RNA-activated protein kinase PKR in tunicamycin-indu

142 s to treat these cells with double stranded (ds) RNAs for gene knockdown.

143 styrene oxide reacted with double stranded (ds)-DNA in the same film, mimicking metabolism and DNA d

144 pyrene [(+/-)-anti-BPDE] to double-stranded (ds) 5'-PO4--ACCCGCGTCCGCGC-3'/5'-GCGCGGGCGCGGGT-3' oligo

145 =50 mM) of KCl, whereas its double-stranded (ds) activity favors 10 mM MgCl(2) and 50 mM KCl or 2 mM

146 ired for repairing both DNA double-stranded (ds) breaks and blocked replication forks.

147 d protein Cas9 to introduce double-stranded (ds) breaks in target DNA.

148 f adenosine (A) in RNA with double-stranded (ds) character, leading to the destabilization of RNA dup

149 man tissue predominantly as double-stranded (ds) circular episomes derived from input linear single-s

150 Double-stranded (ds) DNA and oligonucleotides bind tissue-(tPA) and uroki

151 Autoantigens, such as double-stranded (ds) DNA and the RNA-containing Smith antigen (Sm), may b

152 d oligonucleotide arrays to double-stranded (ds) DNA arrays.

153 Lambda-like double-stranded (ds) DNA bacteriophage undergo massive conformational cha

154 ting technologies introduce double-stranded (ds) DNA breaks at a target locus as the first step to ge

155 th single-stranded (ss) and double-stranded (ds) DNA damage with the latter thought to be the major s

156 e AID access to transcribed double-stranded (ds) DNA during immunoglobulin light chain and heavy chai

157 isoforms bind to an AT-rich double-stranded (ds) DNA element of the rat ENK (rENK) gene.

158 n(2+) blocks end-joining of double-stranded (ds) DNA fragments with 3' overhangs mimicking double-str

159 NAs with cognate homologous double-stranded (ds) DNA in vitro Using magnetic tweezers, we measured th

160 DNA region within a longer double-stranded (ds) DNA molecule.

161 e homologous pairing of two double-stranded (ds) DNA molecules in the absence of proteins, divalent m

162 alt hexamine ions condensed double-stranded (ds) DNA oligomers but not their more highly charged dsRN

163 been well characterized on double-stranded (ds) DNA substrates, where the complementary strand provi

164 (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge o

165 to predict the response of double-stranded (ds) DNA to tension is a cornerstone of understanding DNA

166 Kinetics of the double-stranded (ds) DNA unwinding by the Escherichia coli replicative he

167 have been demonstrated for double-stranded (ds) DNA using NMR spectroscopy.

168 e in the assembly of linear double-stranded (ds) DNA viruses is that their genome is translocated int

169 In most icosahedral double-stranded (ds) DNA viruses, the viral genome enters and exits the c

170 mposed of G-rich repetitive double-stranded (ds) DNA with a 3' single-stranded (ss) overhang and asso

171 el for aqueous solutions of double-stranded (ds) DNA with explicit consideration of electrostatic int

172 tudy of the interactions of double-stranded (ds) DNA with the dirhodium carboxylate compounds Rh(2)(O

173 ear antibody [ANA] and anti-double-stranded (ds) DNA), complement C3 and C4, and changes in renal and

174 th three distinct monolayer double-stranded (ds) DNA-gold nanoparticles (DNA-AuNPs).

175 ear antigens, in particular double-stranded (ds) DNA.

176 sively than those that scan double-stranded (ds) DNA.

177 ences on genomic lengths of double-stranded (ds) DNA.

178 cations to random sequence, double-stranded (ds) DNA.

179 ture of UDG in complex with double-stranded (ds) DNA.

180 ar and circular single- and double-stranded (ds) DNA.

181 ses pairing with homologous double-stranded (ds) DNA.

182 ed on substrates containing double-stranded (ds) DNA.

183 form of RPA to destabilize double-stranded (ds) DNA.

184 HIN domains in complex with double-stranded (ds) DNA.

185 tween stacked 6-MI bases in double-stranded (ds) DNA; this coupling is reduced in single-stranded (ss

186 fficiency of LX ligation of double-stranded (ds) ends is critically dependent upon the length of the

187 , most likely converts to a double-stranded (ds) form, and integrates into the host genome.

188 is in an ss form, not in a double-stranded (ds) form, ss AAV genomes with BrdU can be readily tracke

189 to transcriptionally active double-stranded (ds) forms.

190 nuclear extract to labeled double-stranded (ds) oligonucleotide containing this sequence resulted in

191 xidized a 32 base pair (bp) double-stranded (ds) oligonucleotide representing exon 7 of the p53 gene.

192 nce (RNAi) elicited by long double-stranded (ds) or base-paired viral RNA constitutes the major mecha

193 r chamber interact with the double-stranded (ds) portion of p/tDNA.

194 ration via translocation on double-stranded (ds) rather than single-stranded (ss) DNA.

195 Injection of TcADC double-stranded (ds) RNA (dsTcADC) into mature larvae resulted in depleti

196 cells can take up exogenous double-stranded (ds) RNA and use it to initiate an RNA silencing response

197 The cleavage of double-stranded (ds) RNA by ribonuclease III is a conserved early step in

198 Expressing a double-stranded (ds) RNA corresponding to the A. thaliana gene, decrease

199 iphosphate containing viral double-stranded (ds) RNA from self-RNA by an incompletely understood mech

200 ortance of short, isolated, double-stranded (ds) RNA helices and calls for a complete understanding o

201 Double-stranded (ds) RNA is a key player in numerous biological activitie

202 Double-stranded (ds) RNA is the genetic material of a variety of viruses

203 Double-stranded (ds) RNA of viral origin, a ligand for Melanoma Different

204 y are the primary agents of double-stranded (ds) RNA processing in prokaryotic and eukaryotic cells.

205 of damage-induced nuclear, double-stranded (ds) RNA requires additional phosphorylation of carboxy-t

206 ) to produce inosine (I) in double-stranded (ds) RNA structures, a process known as A-to-I RNA editin

207 degrading a 5' triphosphate double-stranded (ds) RNA substrate, a typical pathogen-associated molecul

208 ved and become template for double-stranded (ds) RNA synthesis.

209 gene transcription produced double-stranded (ds) RNA to activate PKR during vaccinia virus (VACV) inf

210 R is activated upon binding double-stranded (ds) RNA to undergo autophosphorylation.

211 Double-stranded (ds) RNA, a common product of viral infection, can induce

212 Double-stranded (ds) RNA, protein activator PACT and heparin are the thre

213 TLR3)-mediated signaling by double-stranded (ds) RNA, which culminates in the activation of the trans

214 of interferon (IFN)-induced double-stranded (ds) RNA-activated protein kinase (PKR) and is an importa

215 The double-stranded (ds) RNA-activated protein kinase PKR phosphorylates the

216 The double-stranded (ds) RNA-binding protein RAX was discovered as a stress-i

217 e responses and up-regulate double-stranded (ds) RNA-induced innate responses through Toll-like recep

218 interferon (IFN)-inducible double-stranded (ds) RNA-specific adenosine deaminase, downregulates host

219 veral that are triggered by double-stranded (ds) RNA.

220 rprisingly, Cap-0 and 5'ppp double-stranded (ds) RNAs bind to RIG-I with nearly identical Kd values a

221 nce (RNAi) screen of 19,470 double-stranded (ds) RNAs in cultured cells to characterize the function

222 eport that small, noncoding double-stranded (ds) RNAs play a critical role in mediating neuronal diff

223 to bind specifically to the double-stranded (ds) RSS heptamer, but with both weak specificity and aff

224 KR is activated by RNA with double-stranded (ds) structure and subsequently impairs translation throu

225 Ribonuclease III cleaves double-stranded (ds) structures in bacterial RNAs and participates in div

226 sing evidence suggests that double-stranded (ds) T-DNA, converted from T-strands, are potent substrat

227 e II complex and contains a double-stranded (ds)-RNA-binding motif (DRM).

228 hat observed on both linear double-stranded (ds)DNA and (+)scDNA.

229 TTP, but not ATP, to unwind double-stranded (ds)DNA as it translocates from 5' to 3' along single-str

230 hermore, only ssDNA and not double-stranded (ds)DNA competitively inhibits the annealing activity, al

231 AID activity on transcribed double-stranded (ds)DNA containing somatic hypermutation or CSR target se

232 bility to recognize foreign double-stranded (ds)DNA of pathogenic origin in the intracellular environ

233 ction enzyme reactions with double-stranded (ds)DNA oligomers confined in relatively large (and flat)

234 ere stimulated with genomic double-stranded (ds)DNA or IFN.

235 When compared with double-stranded (ds)DNA scanning enzymes, e.g. DNA glycosylases that exci

236 le-stranded (ss)DNA but not double-stranded (ds)DNA substrates in vitro.

237 reformed procapsids in many double-stranded (ds)DNA viruses.

238 ceptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type

239 into extended filaments on double-stranded (ds)DNA.

240 and then translocate along double-stranded (ds)DNA.

241 donuclease activity against double-stranded (ds)DNA.

242 eeding of CYP3RNA, a 791-nt double-stranded (ds)RNA complementary to CYP51A, CYP51B, and CYP51C, resu

243 the response of neurons to double-stranded (ds)RNA delivered by feeding.

244 ritis, contains a segmented double-stranded (ds)RNA genome that replicates using viral mRNAs as templ

245 Double-stranded (ds)RNA in the infected cells is a trait shared by most i

246 Double-stranded (ds)RNA interference (RNAi) is widely used for functional

247 Double-stranded (ds)RNA motifs are central to immune regulation and block

248 study, CXCL-8 regulation by double-stranded (ds)RNA pathways was analyzed in the context of HCV infec

249 itic cells are activated by double-stranded (ds)RNA present in virally infected cells but absent from

250 , which can be triggered by double-stranded (ds)RNA produced during viral replication.

251 Recent studies suggest double-stranded (ds)RNA sequestration is a potential mechanism that allow

252 is activated by blunt-ended double-stranded (ds)RNA with or without a 5'-triphosphate (ppp), by singl

253 rotein kinase that binds to double-stranded (ds)RNA, autophosphorylates its kinase domain, and subseq

254 ) 3, which recognizes viral double-stranded (ds)RNA, on WNV infection.

255 iral nucleic acids, such as double-stranded (ds)RNA--and in turn activate effector functions, includi

256 unctions in tandem with the double-stranded (ds)RNA-binding protein Loquacious (Loqs) to catalyze the

257 It is now apparent that the double-stranded (ds)RNA-dependent protein kinase, PKR, is a regulator of

258 nd activated by blunt-ended double-stranded (ds)RNAs carrying a 5' triphosphate (ppp) moiety.

259 monstrate that ingestion of double-stranded (ds)RNAs supplied in an artificial diet triggers RNA inte

260 faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 A tetrameric

261 (RNase III; EC 3.1.24) is a double-stranded(ds)-RNA-specific endonuclease with key roles in diverse

262 mbled monolayers of a short, double-stranded(ds)[RNA-DNA] chimera enable permanent digital detection

263 When paired, domain-swapped (ds)TCRs assemble with CD3, express on the cell surface,

264 c-polycytidylic acid (poly I:C), a synthetic ds-RNA molecule designed to mimic RNA virus infection.

265 Secondly, we use synthetic ds targets to investigate the effect of DNA methylation

266 gle BLM can lead to ds-DNA cleavage and that ds cleavage can occur using one or two BLM molecules.

267 We show that ds and fz contribute independently to polarity and that

268 However, our studies have suggested that ds cleavage occurs by partial intercalation of BLM's bit

269 a-galactosidase dsRNA (dsbetagal; note that "ds" is used as a prefix to indicate the dsRNA derived fr

270 The ds bonds in purified virions were susceptible to reducti

271 The ds-DNA/p(L-Cys)/Fe3O4 NPs-GO/CPE exhibited an increase i

272 V vs open circuit potential, OCP) caused the ds-DNA to align parallel to the electrode surface, resul

273 tive values (i.e., -0.2 V vs OCP) caused the ds-DNA to reorient perpendicular to the electrode surfac

274 the basis of this finding, we developed the ds-NIF (nucleoside with intrinsic fluorescence)-probe me

275 rporated into the ss RNA was chased into the ds RNA and other larger RNA species.

276 pd binding was found to increase notably the ds-ON melting temperature.

277 eling of docking of oxidizing species on the ds-oligonucleotide were consistent with the experimental

278 regions of the wing, uniform ds rescues the ds mutant PCP phenotype.

279 e polyanionic ON backbone and stabilizes the ds-form relative to the ss-form.

280 ecificity to the ss RSS heptamer than to the ds form.

281 terminus of micro 1, was shown to form this ds bond with the Cys679 residue from another micro 1 sub

282 ntegration of T-DNA molecules occurs through ds intermediates and requires active participation of th

283 ry to the HCV core/E1 region, which binds to ds-Pl and forms PNA/ds-Pl structure.

284 le binding modes of a single BLM can lead to ds-DNA cleavage and that ds cleavage can occur using one

285 (D) = 1.3-1.5 x 10(-9) M) and selectively to ds/ss-DNA junctions that carry both a binding site for P

286 turated calomel electrode (SCE), specific to ds-ON and highly sensitive to base pair mismatches, was

287 ed intermediates that directly transition to ds circular episomes.

288 ite for the SANT/Myb domain of TRF1 or TRF2 (ds-TTAGGGTTA).

289 e most proximal regions of the wing, uniform ds rescues the ds mutant PCP phenotype.

290 hift which was inhibited by excess unlabeled ds oligonucleotide and by a consensus cold Sp-1 ds oligo

291 -siRNA is comparable with that of unmodified ds-siRNA.

292 extracted from cancerous human cells, using ds-NIF methodology.

293 n the Delta C(p) of binding to pt-DNA versus ds-DNA, and a difference in pI for these two complexes,

294 The affinities of the protein for ss- vs. ds-DNA are comparable, and inversely proportional to sal

295 Transfection of chondrocytes with ds-miR-140 down-regulated IL-1beta-induced ADAMTS5 expre

296 ons, its overall poor activity compared with ds-siRNA has prevented its widespread use.

297 ethylmmonium chloride), PDDA, decorated with ds-DNA was employed in this study to identify DNA damage

298 ues poised for nonspecific interactions with ds-DNA.

299 ed on a carbon paste electrode modified with ds-DNA/poly(L-cysteine)/Fe3O4 nanoparticles-graphene oxi

300 maximum amount of Cl(2)(*-) is produced with ds (double-stranded) DNA, where the one-electron-oxidize