ライフサイエンスコーパス: first intron

1 o well-conserved E box elements in the large first intron.

2 the VGLUT1 upstream promoter and the VGLUT1 first intron.

3 w start codon is in the previously annotated first intron.

4 than 10,000 genes and show a bias toward the first intron.

5 3'-alternative splice site selection of the first intron.

6 transcription initiation site and within the first intron.

7 from the transcription start) or within the first intron.

8 se element and a Sp1 site located within the first intron.

9 T-cells-c2 to consensus sequences within the first intron.

10 alternative 3' splice site selection in the first intron.

11 he UG repeats near the 3'-splice site in the first intron.

12 ent in the promoter and sequences within the first intron.

13 ents in the proximal promoter and within the first intron.

14 an extended promoter construct spanning the first intron.

15 itional factors, C/EBP and USF, bound in the first intron.

16 on-sensitive manner to sites within the BCL6 first intron.

17 tor sequence located 1100 bp upstream of the first intron.

18 e for the promoter-enhancing activity of the first intron.

19 e Gld is activated by an enhancer within the first intron.

20 /HAF1 at -182, the latter three being in the first intron.

21 h overlaps with the splice donor site of the first intron.

22 s within both the 5' flanking region and the first intron.

23 ements within both the putative promoter and first intron.

24 ighly inducible binding to a site within the first intron.

25 ne via a conserved STAT3-binding site in the first intron.

26 ivation of a regulatory element in the SMAD3 first intron.

27 similar CTCF-cohesin binding site within the first intron.

28 hin upstream or intronic regions, especially first introns.

29 am and downstream of coding sequences and in first introns.

30 lly affecting selection of 5' splice site of first introns.

31 ired an E-box cis-element located within the first intron (+2,627) of the N-cadherin gene.

32 a stretch of 110 bases immediately 5' to the first intron 23 bp upstream of the ATG start codon is re

33 egion of the promoter or substitution of the first intron abolished ischemia-induced MMP-2 transcript

34 -flanking sequences, the first exon, and the first intron activated expression in endothelial cells o

35 mutagenesis of the splice donor site of the first intron affects both correct splicing and transcrip

36 In one line, hAFP was introduced into the first intron after the translational start codon; in the

37 also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds

38 ng the promoter, some enhancers, first exon, first intron and a small part of the second exon of UBC.

39 aposed to two other sites located within the first intron and downstream of Ifng, where CTCF, cohesin

40 CF consensus binding elements located in the first intron and downstream of the IRS1 transcriptional

41 and Shahdara identified two deletions in the first intron and immediately downstream the gene in Bay-

42 ivates expression of ndr2 via binding to its first intron and is required for ndr2 expression in the

43 ecause it contains a bona fide p53 bs in its first intron and its expression highly correlates with T

44 pression of PP2A by binding to a site in the first intron and modulating chromatin modifications at t

45 By combining first intron and promoter interactions, we found that ge

46 d to an E-box-containing region in the PEG10 first intron and site-directed mutagenesis showed that t

47 s were also spliced between the donor of the first intron and the acceptor of the second intron.

48 esulting in alternative splicing in both the first intron and the last intron.

49 eeds: two positive regulatory regions in the first intron and the sequence between -425 and -207, and

50 a candidate motif that is overrepresented in first introns and whose occurrence in tested introns is

51 some 17 (403A in the promoter, In1.1C in the first intron, and 3'222C in the 3' untranslated region)

52 E) in the promoter region and an ISRE in the first intron, and is induced by the IFN-triggered Jak-ST

53 f the TSS, G-richness is concentrated in the first intron, and on the nontemplate strand, where polym

54 that differ with respect to splicing of the first intron are detected, there is no indication that t

55 TFs that bind first introns are largely different from those binding p

56 First introns are longer than other introns in multiple

57 icularly those for families enriched in long first introns, are more conserved in length, have more c

58 We found that deletion of sequences in the first intron between +653 and +744 decreased the T3 indu

59 The first intron between the first exon and the exon with th

60 eron-stimulated response element site in the first intron binds interferon-stimulated gene factor 3 (

61 preferentially located towards the 5'-end of first introns but also appear to be enriched in 5'-UTRs

62 tion of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector

63 both in isolation and in the context of the first intron conferred p53-dependent transcriptional act

64 ies indicate that the 3.13-kilobase promoter/first intron confers essentially normal CSF-1 expression

65 Pbeta was driven by a 3.6-kb Col1a1 promoter/first intron construct, and four transgenic (TG) mouse l

66 sing a 56-bp region of the mouse alpha-actin first intron containing SRF, NFAT, and AP-1 sites (SNAP)

67 First, intron-containing pre-mRNAs in yeast are detectab

68 The first intron contains both positive and negative regulat

69 two introns; non-canonical sequences in the first intron contribute to its retention, a common form

70 er, whereas in barley, mutations in the HvFT first intron differentiate plants with dominant and rece

71 e show that the VGLUT1 upstream promoter and first intron each support glutamatergic-specific express

72 the transcription start site and 5' ends of first introns (false discovery rate < 0.001) of genes do

73 utative AcTPase promoter or the promoter and first intron from the maize ubiquitin (Ubi1) gene, and p

74 The ability of the first introns from both the TRP1 and POLYUBIQUITIN10 (UB

75 The VGLUT1 upstream promoter or the first intron, fused to the basal promoter, each supporte

76 Inclusion of the first intron had no effect on promoter activity.

77 scription start site (most frequently in the first intron), have multiple GATA1-occupied segments tha

78 tive sites in the 5'-flanking region and the first intron in all three cells correlated with relative

79 ical retinoic acid-responsive element in the first intron in the IGFBP-6 gene adjacent to a consensus

80 Here we explore the importance of first introns in TF binding in the nematode Caenorhabdit

81 We also describe the first introns in this deep-branching lineage.

82 s-regulatory elements in introns (especially first introns) in genes under strong selective constrain

83 served exon-intron organization in which the first intron interrupts the C-terminal protein coding re

84 a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts d

85 iate early (MIE) transcripts initiate in the first intron, intron A, of the previously defined MIE tr

86 In these mouse lines, the first intron is required for T3 induction as well as hig

87 he enhancer element, which is located in the first intron, is necessary for high-level and cartilage-

88 urthermore, we show that cis-splicing of the first intron located in downstream positioned genes in t

89 anscriptional splicing is less efficient for first introns, longer introns, and introns annotated as

90 ase I-hypersensitive site in HL60 DNA in the first intron may be related to the high serglycin expres

91 The first intron occurs within the signal peptide region and

92 s question more thoroughly, sequences of the first intron of a single copy nuclear gene, PISTILLATA,

93 l stop cassette (neostop) located within the first intron of a target gene.

94 STAiR2 originates from the first intron of a tumor suppressor gene.

95 We identify rs651007 (MAF=20%) in the first intron of ABO at the putative promoter of an antis

96 redefined regulatory elements and within the first intron of all genes.

97 which a gene trap has been inserted into the first intron of annexin IV.

98 gion of mouse/human sequence homology in the first intron of Bcl-6, which is a candidate site for suc

99 l STAT-binding regions in the first exon and first intron of BCL6 that fell within regions of high in

100 In mouse and human, the first intron of Blcap/BLCAP contains the distinct Neuron

101 e GAA-repeat expansion is present within the first intron of both FRDA alleles, that results in trans

102 ying a conserved p53 response element in the first intron of both the human and the murine bax genes.

103 a2b region, a bona fide AID target, into the first intron of c-myc.

104 utations is a GGGGCC repeat expansion in the first intron of C9ORF72 As shown by recent intensive stu

105 A hexanucleotide repeat expansion in the first intron of C9ORF72 has been shown to be responsible

106 anucleotide (GGGGCC) repeat expansion in the first intron of C9ORF72 on the affected haplotype.

107 ently, an expansion of GGGGCC repeats in the first intron of C9orf72 was found to be a common cause o

108 anucleotide (GGGGCC) repeat expansion in the first intron of C9ORF72, a gene located on chromosome 9p

109 hic frequency, and a previously unrecognized first intron of CACNB4 that interrupts exon 1 at codon 2

110 tains a 3,444-bp transposon insertion in the first intron of CAD2 gene.

111 sion through RBP-Jkappa binding sites in the first intron of CD21 and in the CD23a core promoter, res

112 ion of the unique open chromatin site in the first intron of COL1A2 using a transgenic mouse model.

113 genome in which the 5'-UTR, first exon, and first intron of COX1 are fused to the fourth codon of AT

114 ectly to cis-regulatory sequences within the first intron of CSE to activate transcription.

115 ative Klf5 binding sites in the promoter and first intron of Dmp1 and Dspp genes that are homologous

116 e effect of Klf5 on Dspp activity was in the first intron of Dspp gene.

117 e identified a cis-regulatory element in the first intron of dSUR, which contains Tinman consensus bi

118 ed Mtg16 near an E2A binding site within the first intron of E2F2.

119 , caused by insertion of a promoter into the first intron of each gene, leads to NF-kappaB-dependent

120 onsensus binding sequence in the promoter or first intron of Eig3, E2F regulation may be indirect.

121 The first intron of eno2 was spliced with high fidelity and

122 a well described polymorphic sequence in the first intron of ERalpha (PvuII and XbaI) has a key role

123 shows that the trap vector is located in the first intron of Fem1c, a gene homologous to the sex-dete

124 We have identified a 1.7-kb region in the first intron of Fgf10 that is necessary and sufficient t

125 SNPs in the first intron of FTO (fat mass and obesity associated) ar

126 hat the obesity-risk allele rs8050136 in the first intron of FTO alters a regulatory element recogniz

127 The first intron of FTO contains common single nucleotide po

128 Variants located in the first intron of FTO were unequivocally associated with a

129 on of triplex-forming GAA/TTC repeats in the first intron of FXN gene results in Friedreich's ataxia.

130 s GAA trinucleotide repeat expansions in the first intron of FXN occur in 96% of affected individuals

131 d results from an expanded GAA repeat in the first intron of FXN.

132 MIST1 bound CATATG/CAGCTG E boxes in the first intron of genes that regulate autophagosome/lysoso

133 found primarily in or near the 5'-UTR or the first intron of genes, and seldom in the intergenic regi

134 directly binding to the E-box element in the first intron of HP1gamma gene, and the upregulated HP1ga

135 spring accessions contain a deletion in the first intron of HvBM5A that may be important for regulat

136 s transcribed from a promoter present in the first intron of LEF1 gene and undergoes splicing in mese

137 phism within a super-enhancer element in the first intron of LMO1 influences neuroblastoma susceptibi

138 etylation of histone H3 lysine 27 within the first intron of LMO1.

139 The transcription factor MIST1 bound the first intron of Mib1 and regulated its expression.

140 ization of a tissue-specific enhancer in the first intron of murine Nfatc1 that activates a heterogen

141 ed switch mu region, S mu, were found in the first intron of Myc in lymph node cells of IL-6 transgen

142 Furthermore, the splicing efficiency of the first intron of nad2, encoding for another complex I sub

143 dentified a transposon insertion site in the first intron of Nmnat2 (Nicotinamide mononucleotide aden

144 ta, FLCD maps to a structural variant in the first intron of pdm3; however, this variant is not found

145 e that is repeated multiple times within the first intron of Peg3 in all three mammals.

146 factor Ikaros binds to a variant site in the first intron of PP2A and modulates its expression.

147 by inserting a core Sgamma1 region into the first intron of proto-oncogene Bcl6, which is a non-Ig t

148 iquitously expressed gene located within the first intron of Runx2.

149 ression of S100A4 and hypomethylation of the first intron of S100A4 was statistically significant (P

150 muscle-specific enhancer activity within the first intron of smooth muscle calponin.

151 ining the 5' region of the p23 gene into the first intron of Tbx10, which causes ectopic expression o

152 directly bound to two strong E-boxes in the first intron of Tead2 by chromatin immunoprecipitation a

153 pha, an intronless gene, rearranges with the first intron of TFEB, just upstream of TFEB's initiation

154 p enhancer located at position + 23.5 in the first intron of the 224-kb mouse Runx1 gene.

155 sue-specific transcriptional enhancer in the first intron of the alpha2(XI) collagen gene (Col11a2).

156 ly located AP1 binding sites residing in the first intron of the BCSG1 gene.

157 binding sites, 5'-AAGTG, and is part of the first intron of the Beadex gene.

158 a kappaB cis-DNA element located within the first intron of the bic gene.

159 cludes additional regulatory elements in the first intron of the Bim gene.

160 One CNS located in the first intron of the c-fos gene conferred regulation by c

161 The variant rs26232, in the first intron of the C5orf30 locus, is associated with th

162 ansions of a non-coding GGGGCC-repeat in the first intron of the C9orf72 gene are a common cause of b

163 Expanded GGGGCC repeats in the first intron of the C9orf72 gene represent the most comm

164 GGGCC hexanucleotide repeat expansion in the first intron of the C9ORF72 gene.

165 functional INE (intronic element) within the first intron of the Cat-1 gene was identified and charac

166 through a paired-domain DNA sequence in the first intron of the CCN3 gene.

167 A silencer element within the first intron of the CD4 gene is sufficient for CD4 trans

168 by a transcriptional silencer located in the first intron of the CD4 locus.

169 (CEB-MARE), from +2,628 to +2,641 bp in the first intron of the CHOP gene, activates it.

170 The variant rs26232, in the first intron of the chromosome 5 open reading frame 30 (

171 ent in the CPT-I alpha gene promoter and the first intron of the CPT-I alpha gene.

172 ha-luciferase transgenes with or without the first intron of the CPT-Ialpha gene.

173 identified a p53-binding site (p53BS) in the first intron of the DcR2 gene.

174 is almost identical to the one found in the first intron of the DR5 gene in terms of their locations

175 loma cell lines, recruitment of c-Rel to the first intron of the Ezh2 locus promoted Ezh2 mRNA expres

176 s, we identified a cis-acting element in the first intron of the flk1 gene that is required for endot

177 y conserved STAT-binding site located in the first intron of the FOXP3 gene.

178 Expansion of a GAA . TTC repeat in the first intron of the frataxin (FXN) gene causes an mRNA d

179 Large expansions of GAA.TTC repeats in the first intron of the frataxin (X25) gene are the principa

180 d by the expansion of GAA.TTC repeats in the first intron of the frataxin (X25) gene.

181 Expansions of (GAA)n repeats within the first intron of the frataxin gene reduce its expression,

182 expansion of a GAA.TTC triplet repeat in the first intron of the frataxin gene.

183 ed by expansions of the (GAA)n repeat in the first intron of the frataxin gene.

184 GAA triplet-repeat (GAA-TR) sequence in the first intron of the FRDA gene.

185 pansion of an unstable GAA.TTC repeat in the first intron of the FXN gene causes Friedreich ataxia by

186 rexpansion of GAA*TTC repeats located in the first intron of the FXN gene, which inhibits transcripti

187 e triplet-repeat sequence GAA.TTC within the first intron of the FXN gene.

188 ssociated with a GAA repeat expansion in the first intron of the gene (FRDA) encoding a novel, highly

189 emly repeated, transposable element into the first intron of the gene cortex.

190 pansion of a trinucleotide repeat within the first intron of the gene that encodes frataxin.

191 ich negative regulatory (PNR) element in the first intron of the gene, which is essential for its car

192 ghly conserved FOXO binding sites within the first intron of the gene.

193 sis of an existing P-element inserted in the first intron of the gene.

194 lements, two in the 5' region and one in the first intron of the gene.

195 serum response factor, is located within the first intron of the H2-Ealpha gene.

196 n of the U3His gene trap retrovirus into the first intron of the hnRNP C1/C2 gene.

197 ed E-boxes (DNA recognition elements) in the first intron of the human and mouse PEDF promoter region

198 e that the intragenic CpG islands within the first intron of the human BCL6 locus were hypermethylate

199 ctor DNA-binding domain designed to bind the first intron of the human CCR5 gene.

200 ersensitivity sites were detected within the first intron of the human CYP7A1 gene, but only in HepG2

201 isolated and characterized the promoter and first intron of the human IRF-7 gene.

202 G boxes located in the proximal promoter and first intron of the human KCNMB1 gene.

203 We previously demonstrated that the first intron of the human von Willebrand factor (vWF) is

204 tes in the 5' untranslated region and in the first intron of the K(v)7.4 gene were identified by bioi

205 Moreover, a p53 response element within the first intron of the KARP-1 transcriptional unit was iden

206 at the CTCF-cohesin binding site within the first intron of the latency transcript.

207 binding sites bound in vivo by GATA-3 in the first intron of the lipid acyltransferase gene AGPAT5.

208 The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activ

209 is derived from a promoter found within the first intron of the longer form.

210 roximately 200 kilobase (kb) deletion in the first intron of the MAGI1 gene was identified that segre

211 en either a 3.2-kb 5' extended region or the first intron of the mCAR gene was tested in Weri-Rb-1 ce

212 d major sites of Egr2 interaction within the first intron of the Mpz gene and approximately 5 kb upst

213 tified a highly conserved element within the first intron of the Mpz gene, which contains binding sit

214 y seven distinct regulatory areas within the first intron of the murine CD21 gene that are conserved

215 on of a regulatory region located within the first intron of the murine GATA-3 gene.

216 g one with tandem STAT5 binding sites in the first intron of the NCAM2 gene.

217 here that two adjacent enhancers inside the first intron of the neighboring (1.4 kb downstream) ATPa

218 ivating protein 1 (AP-1) binding site in the first intron of the NGF gene.

219 expressed from an alternate promoter in the first intron of the p21 gene.

220 response-element motifs in the promoter and first intron of the p21(WAF1/CIP1) gene that respond to

221 wed that PPR4 is associated in vivo with the first intron of the plastid rps12 pre-mRNA, a group II i

222 ts in a block containing the 5' promoter and first intron of the PTGER4 gene (encoding prostaglandin

223 ruitment to two response elements within the first intron of the PTP1B encoding gene PTPN1, correlati

224 ensus p53-binding site was identified in the first intron of the RPS27L gene and a direct binding of

225 We found that three CpG sites in the first intron of the S100A4 gene were approximately 90% m

226 -1-binding site, GCGTG was identified in the first intron of the SAG gene.

227 stimulating gene expression is the 1,028-bp first intron of the Sh1 gene that encodes maize (Zea may

228 ing the promoter, first exon and most of the first intron of the Sorcs1 gene.

229 via a novel AP-1 element located within the first intron of the sphk1 gene.

230 G-rich element from +171 to +179 within the first intron of the STAT1 gene is critical for optimal S

231 We detected STAT5A/B binding sites in the first intron of the Tfr1 gene and found that expression

232 gene flanked by lox P sites targeted to the first intron of the Th gene.

233 A SNP that maps to the first intron of the Tolloid-Like 1 gene (TLL1) showed th

234 The first intron of the trout IFN-gamma gene contains highly

235 in the promoter and in a cluster within the first intron of the VEGF gene.

236 and replication of a polymorphism within the first intron of the WISP3 gene have been shown in patien

237 Large deletions in the first intron of the With No lysine (K) 1 (WNK1) gene are

238 Deletions in the first intron of the WNK1 gene were found in a group of h

239 the trinucleotide repeat GAA*TTC within the first intron of the X25 (frataxin) gene cause Friedreich

240 ding element AGGTCA separated by 4 bp in the first intron of the Xenopus ST3 gene.

241 lexes bind a DNA enhancer element within the first intron of the YAP gene to drive YAP expression in

242 We show that (CCTG) x (CAGG) repeats, in the first intron of the ZNF9 gene associated with myotonic d

243 by a (CCTG)/(CCUG)n repeat expansion in the first intron of the ZNF9 gene.

244 the association findings for two SNPs in the first intron of TLL1, rs6812849 and rs7691872, with p va

245 assays and the knockin mice, the loss of the first intron of vWF resulted in a significant reduction

246 or (A) allele of rs8060701, a variant in the first intron of ZFHX3, was associated with a 1.16-fold d

247 d with deletions in the promoter regions and first introns of A. arenosa FLCs.

248 We found that first introns of C. elegans genes, particularly those fo

249 wed that defined non-coding regions, such as first introns of genes and regulatory domains, are assoc

250 presence of MSR1 repeats in the promoters or first introns of genes is associated with greater popula

251 is almost identical to the ones found in the first introns of other three TRAIL receptor genes.

252 d in transcription termination events within first introns of pc genes.

253 nds preferentially to certain E-boxes within first introns of specific gene isoforms.

254 Y) is strongly enriched in the promoters and first introns of VAL-repressed genes, including the earl

255 g one or more G4 motifs at the 5'-end of the first intron, on the non-template DNA strand.

256 cus in the absence or presence of the native first intron or heterologous introns from the human beta

257 G >T) located in the 5' upstream regulatory, first intron or promoter regions.

258 ing a region upstream of PTEN and the gene's first intron (P=.0027).

259 In addition, elements in the first intron participate in the T3 induction of CPT-Ialp

260 meres and are enriched in gene promoters and first introns, raising the possibility that perturbation

261 The promoter and first intron regions of the human Hsp27 gene were cloned

262 gene fusions to identify features of the Sh1 first intron required for enhancement in cultured maize

263 y that the 9.0 kb upstream sequences and the first intron residing in the 5' untranslated area are cr

264 ic sequences revealed three introns with the first intron residing within the 5'-untranslated region.

265 ons just after the stop codon and within the first intron, respectively.

266 ew exon (exon 1.2) was identified within the first 'intron' resulting in novel splice variants in TM3

267 Also, lacZ driven by the same promoter/first intron revealed beta-galactosidase expression in h

268 The small DNA fragment contains the first intron sequence located downstream of the first ex

269 4 are intron-free, while Cell-2 contains the first intron sequence to be identified from a termite sy

270 binding of GATA-4 and IRF-1 and IRF-2 to the first intron sequence.

271 individual cis-acting elements, such as the first intron sequence.

272 sted the potential of the highly polymorphic first intron sequences from members of the plant beta-tu

273 d a significant positive correlation between first intron size and the number of TF interactions obta

274 can Americans (P = 0.004), but haplotypes of first intron SNPs -4,521 to -657 did not (P > 0.2).

275 ription of SAMD4A, a gene with a 134 kb-long first intron, splicing joins the 3' end of exon 1 to suc

276 tion of the selection gene cassette into the first intron suppressed the corrected allele transcripti

277 (VWF) gene between -2812 and the end of the first intron (termed vWF2) was previously shown to direc

278 ct an Egr2-responsive element within the Mpz first intron that also contains binding sites for the tr

279 ll receptor-responsive enhancer in the FoxP3 first intron that is dependent on a cyclic-AMP response

280 he HDMX gene contains a promoter (P2) in its first intron that is potentially inducible by p53.

281 transcripts included the beta-globin gene's first intron, the PRE, PPE and CJE still enhanced mRNA b

282 sequences of three E-box sites within PHM's first intron; the sites make different contributions to

283 c-Myc could bind to a conserved site in the first intron to activate the promoter.

284 A within the MIE gene at the position of the first intron to affect RNA polymerase II function during

285 d either the VGLUT1 upstream promoter or the first intron to this basal promoter.

286 ent splicing of the B19V pre-mRNA within the first intron (upstream of the (pA)p site) stimulated the

287 Z transgene construct from -2600 through the first intron was expressed in myofibroblasts within gran

288 However, only the ISRE present in the first intron was functional and conferred interferon ind

289 rat aggrecan gene (83 kb including the 30-kb first intron) was surveyed for active elements, which wo

290 from the CD68 gene, in addition to the CD68 first intron, was able to direct macrophage-specific exp

291 13 kilobases of the mouse CSF-1 promoter and first intron were characterized.

292 ion start site, and a CpG-rich region in the first intron were hypermethylated in HCC cells.

293 6-kb DNA fragment including the promoter and first intron, were also induced.

294 s mediated through a region within the ERBB2 first intron which can act as an oestrogen-suppressible

295 to bind to P5CS1 regulatory sequences in the first intron, which carries a conserved PHR1-binding sit

296 An "eye enhancer" was localized to the first intron, which controls specific expression in the

297 tragenically located and includes the 558-bp first intron, which is responsible for high-level expres

298 th transcript contributes to assembly of the first intron, which is thus tripartite.

299 d Nodal response element (NRE) in the squint first intron, while expression in the extra-embryonic en

300 We show that the first introns within most genes play a particularly impo