ライフサイエンスコーパス: inverted repeat

1 rgeted sequences resembling the Ty3 terminal inverted repeat.

2 r the HetR protein so far, a seven-base pair inverted repeat.

3 onucleotide corresponding to the Mu terminal inverted repeat.

4 ing transcription factor binding sites or an inverted repeat.

5 rangement, including large expansions of the inverted repeat.

6 upstream of tbpA and separated from it by an inverted repeat.

7 ymmetry centred on a conserved 5'-TAC/GTA-3' inverted repeat.

8 bacterial recombination site that is not an inverted repeat.

9 multiple genes that contain poorly conserved inverted repeats.

10 y in regions that contain numerous tandem or inverted repeats.

11 as does a pair of synthetically constructed inverted repeats.

12 repeats and is demarcated by 8-bp imperfect inverted repeats.

13 ends to underestimate the expected number of inverted repeats.

14 ter families, many of which contain internal inverted repeats.

15 n transposon target sites and their terminal inverted repeats.

16 tation, can generate a substantial excess of inverted repeats.

17 gments and genes interspersed with noncoding inverted repeats.

18 ints such as purine-rich tracts or direct or inverted repeats.

19 the production of small RNAs from endogenous inverted repeats.

20 rize, as their breakpoints often fall within inverted repeats.

21 ir respective initiator proteins arranged as inverted repeats.

22 acentric inversion sponsored by >300-kb-long inverted repeats.

23 L) and a unique short region (US) flanked by inverted repeats.

24 e polintovirus PolB gene along with terminal inverted repeats.

25 erated by flanking a DNA sequence with short inverted repeats.

26 ate short inversions, some flanked by paired inverted repeats.

27 namely sites of convergent transcription and inverted repeats.

28 An inverted repeat 0 (IR-0) FXR response element, acting as

29 repertoire of sites with DR0, DR8, and IR0 (inverted repeat 0) elements.

30 ostly in intergenic and intron regions at an inverted repeat 1 motif in both groups, but also cluster

31 d repeat spaced by one nucleotide DNA motif, inverted repeat-1 (5'-AGGTCAcAGACCT-3'), as a likely FXR

32 ium coupled cotransporters of the five-helix inverted repeat (5HIR) superfamily use an alternating ac

33 nd subterminal repeats of the Muta1 terminal inverted repeat also influence Muta1 transposition.

34 ound that it has a single exon that includes inverted repeat Alu elements (IRAlus).

35 In many cells, mRNAs containing inverted repeated Alu elements (IRAlus) in their 3' untr

36 In many cells, mRNAs containing inverted repeats (Alu repeats in humans) in their 3' unt

37 rms around a single centromere flanked by an inverted repeat and was found as an independent chromoso

38 endent, particularly those derived from long inverted repeats and a subset of tandem repeats.

39 Rather, they are flanked by nearly identical inverted repeats and enclosed within direct repeats, sug

40 nontransposon sequences have longer terminal inverted repeats and higher GC content in terminal and s

41 o demonstrate a novel method for identifying inverted repeats and inversion variants, both of which c

42 only the oligo(T) trail sequence and not the inverted-repeat and loop region.

43 aining segment, five 9-bp direct repeats, an inverted repeat, and a sigma(A)-dependent promoter for t

44 at involves both homology-driven events, via inverted repeats, and microhomologous or nonhomologous e

45 In addition, the boundaries of inverted repeats are hot spots for gene duplications or

46 duces precise nicks in the degenerate, short inverted repeats at the ends of linear viral DNA.

47 AccR-P binds in vitro to a conserved inverted repeat (ATGCA-N6-TGCAT) present at two differen

48 n an uncharacterized protein that we termed "Inverted Repeat Binding Protein (IRBP) 18" and its partn

49 ing of tandem copies of the ethanol receptor inverted repeat binding site, in combination with a mini

50 ls, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple

51 The edited cytidines are often flanked by inverted repeats, but are largely distinct from those de

52 ation that closed-circular DNA containing an inverted repeat can release the free energy stored in ne

53 Thus inverted repeats can act as an important force in evolut

54 h breakpoints embedded within long (>100 kb) inverted repeats can be genotyped by haplotype-fusion PC

55 its inherent instability in genomic DNA, the inverted repeat catalyzes spontaneous self-excision, res

56 s present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for

57 terminal three nucleotides of the P-element inverted repeats complement and restore the original TSM

58 our of the breakpoint regions included large inverted repeats composed of repetitive gene clusters an

59 ysis across the genome found that the large, inverted repeats comprise a recombination hot spot.

60 transgenic loci have two T-DNA copies in an inverted repeat configuration, centered at the right bor

61 sis of closely linked transposon ends in the inverted-repeat configuration and therefore suppresses t

62 l density analysis determined that the large inverted repeats constitute a recombination hot spot.

63 We inserted an inverted repeat containing a fluorophore-quencher pair i

64 An inverted repeat-containing sequence in the hepA promoter

65 terial chromosome that consists of a pair of inverted repeat core sites called B and B' in attB.

66 rocess where one copy of a small, imperfect, inverted repeat corrects the other copy via strand misal

67 he absence in M. truncatula of the prominent inverted repeat cpDNA sequence found in most plant speci

68 the target gene and sequence features of the inverted repeat did not reveal any factors capable of pr

69 However, expression of an inverted-repeat double-stranded RNA corresponding to the

70 Here, we show that small (5-9 bp) inverted repeats drive the formation of large palindromi

71 is initiated by restricted expression of an inverted-repeat dsRNA specifically in the Arabidopsis (A

72 ed His-tagged RpaR (His(6)-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the

73 n and that of downstream genes by binding an inverted repeat element in its upstream region.

74 Two in silico-identified inverted repeat elements were not involved in the respon

75 ion of intrachromosomal amplicons with large inverted repeats (equivalent to homogeneously staining r

76 Upstream of cwpV, inverted repeats flank a 195 bp sequence which undergoes

77 on-target sequences that consist of two 13bp inverted repeats flanking a 6 or 8bp spacer sequence.

78 ind that Epe1 is preferentially recruited to inverted repeats flanking centromeres to restrain the sp

79 re posit that backsplicing is facilitated by inverted repeats flanking the circularized exon(s).

80 ermination signal in DNA consists of a short inverted repeat followed by a T-rich stretch.

81 e 7-1-7 repeat element, Zur requires a 9-1-9 inverted repeat for high-affinity binding.

82 anism by which RNAs transcribed from the CHS inverted repeat form aberrant double-stranded RNAs that

83 a precursor in which an imperfectly matched inverted repeat forms a partly double-stranded region.

84 VC2773 and VC2772 form a parABS system with inverted repeats found near the large chromosome origin.

85 gestive of an evolutionary antecedent of the inverted repeats found within the subunits of many membr

86 most likely are ancient remnants of terminal inverted repeats from a long-lost TE.

87 sion of GCRs in other studies, we found that inverted repeat fusion has a profile of genetic regulati

88 Here we analyzed inverted repeat fusion in mutants of three sets of genes

89 This inverted repeat fusion reaction forms dicentric chromoso

90 e find that two checkpoint pathways suppress inverted repeat fusion, and that their activities are di

91 nd Dun1 act independently of Exo1 to prevent inverted repeat fusion.

92 or disrupted DNA replication forks can cause inverted repeat fusion.

93 , activity of Rad53 is sufficient to prevent inverted repeat fusion.

94 alensis and described proliferation of small inverted repeats (hairpins) that occurred in it since th

95 hybrid nixA-ureA promoters demonstrated that inverted repeat half-sites, spacers, and flanking DNA ar

96 The upstream region of orf2c contained two inverted-repeat half sites.

97 ing of these cavities is synchronized by the inverted repeat helices 3 and 8, providing the structura

98 ss the ainS-ainR junction, including a large inverted repeat in ainR.

99 We found that this inverted repeat in cis can affect accumulation of the Ai

100 h operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front

101 leads to nicking of ICEBs1 between a GC-rich inverted repeat in oriT, and NicK was the only ICEBs1 ge

102 vated by BmaR1 and octanoyl-HSL, and a 20-bp inverted repeat in the bmaI1 promoter is required for bm

103 more, in human Colo320DM cancer cells, a DNA inverted repeat in the genome marks the border between a

104 e report here that a specific pair of nearby inverted repeats in budding yeast fuse to form a dicentr

105 hown that there is a large excess of perfect inverted repeats in many prokaryotic genomes but not in

106 finally we present results from a search for inverted repeats in the dog genome using both indel and

107 mation of large DNA palindromes and that DNA inverted repeats in the genome determine the efficiency

108 regulated process that is facilitated by DNA inverted repeats in the genome.

109 eaks (DSBs) introduced a large distance from inverted repeats in the yeast (Saccharomyces cerevisiae)

110 We propose a model called short-inverted repeat-induced synthesis in which DNA synthesis

111 However, like RDR6, SDE5 is not involved in inverted repeat-induced transgene silencing or the bioge

112 guided by the leader sequence and a pair of inverted repeats inside the CRISPR repeat.

113 For species with minor inverted repeat (IR) boundary changes in the plastid gen

114 We show that inverted repeat (IR) boundary elements flanking the fiss

115 wn to be several times slower in the plastid inverted repeat (IR) compared with single-copy (SC) regi

116 wo genes (clpP, rpoC1), and expansion of the inverted repeat (IR) into both large and small single-co

117 A specific RhpR-binding site containing the inverted repeat (IR) motif GTATC-N6-GATAC, was mapped to

118 The total genome size is 162,321 bp, with an inverted repeat (IR) of 27,273 bp, large single-copy (LS

119 the identity of the MerR binding site as an inverted repeat (IR) sequence overlapping the transcript

120 The inverted repeat (IR) sequences delimiting the left and r

121 form extrusion at both perfect and imperfect inverted repeat (IR) sequences.

122 a long noncoding RNA (lncRNA) containing an inverted repeat (IR) with >80% identity to W1-COE The Iw

123 gumes, which also lost one copy of the large inverted repeat (IR).

124 structing an effector gene that expresses an inverted-repeat (IR) RNA derived from the premembrane pr

125 RNA interference suppression of this gene in inverted-repeat (ir)JAZh plants deregulated a specific b

126 DNA inverted repeats (IRs) are hotspots of genomic instabili

127 eletion mutants, we found that the number of inverted repeats (IRs) flanking the promoter is variable

128 enetic instability at palindromes and spaced inverted repeats (IRs) leads to chromosome rearrangement

129 ,528 bp in length, composed with one pair of inverted repeats (IRs) of 26,819 bp, which were separate

130 Palindromic sequences, or inverted repeats (IRs), in DNA sequences involve importa

131 In F and related plasmids, an inverted repeat is located near the plasmid strand cleav

132 One isoform that contains the inverted repeat is retained in the nucleus, whereas anot

133 s suggests that the reported large excess of inverted repeats is due to repeats found in intergenic r

134 We next show that fusion of nearby inverted repeats is general; we found that many nearby i

135 n many chloroplast genomes, the inference of inverted repeats is needed in chloroplast phylogeny anal

136 ncatula is a legume species belonging to the inverted repeat lacking clade (IRLC) with trifoliolate c

137 In Inverted Repeat-Lacking Clade (IRLC) legumes such as Med

138 Within nodules of inverted repeat-lacking clade (IRLC) legumes, rhizobia d

139 In rhizobial species that nodulate inverted repeat-lacking clade (IRLC) legumes, such as th

140 In the Inverted Repeat-Lacking Clade (IRLC) of legumes, this di

141 er, in a large subclade of the Fabaceae, the inverted repeat-lacking clade (IRLC), of which pea is a

142 Here, we show that an inverted repeat located between positions -1144 and -113

143 nce analysis, we have now identified a 77-bp inverted repeat located upstream (206 bp) of the start c

144 BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis

145 Inverted repeats located as far as 21 kb from each other

146 nding sites reveals that the tetranucleotide inverted repeats long believed to be important for C-pro

147 They have only been observed in the inverted repeat loss clade (IRLC) of legumes, which incl

148 A similar inverted repeat-mediated mechanism may underlie structur

149 ing Z-DNA motifs, quadruplex-forming motifs, inverted repeats, mirror repeats and direct repeats and

150 uding Z-DNA, G-quadruplex, A-phased repeats, inverted repeats, mirror repeats, direct repeats and the

151 co-transport proteins that use a five-helix inverted repeat motif have recently emerged as one of th

152 ps each characterized by a distinct terminal inverted repeat motif.

153 Terminal inverted repeat MULEs are the predominant MULE type and

154 ions in the binding sites that conserved the inverted repeat nature of the sites.

155 nsable for GC-induced evolutionary conserved inverted repeated negative GC response element (IR nGRE)

156 lusive for GC-induced evolutionary conserved inverted repeated negative GC response element (IR nGRE)

157 s not large and cannot explain the excess of inverted repeats observed in real data.

158 In at least one haplotype, inverted repeats occur more frequently than elsewhere in

159 roplast DNA is 159,370 bp in size and has an inverted repeat of 21,665 bp.

160 afQ-(DinJ)2-YafQ or a DinJ dimer at a single inverted repeat of its recognition sequence that overlap

161 the central axis of the channel, without the inverted repeat of mammalian-type urea transporters.

162 nation, a mutagenesis cassette containing an inverted repeat of selection marker(s) is integrated int

163 presence of the known CmeR-binding site, an inverted repeat of TGTAAT, in the promoter region of Cj0

164 rder of the small single copy region and the inverted repeat of the chloroplast genome.

165 ter, which is composed of a highly conserved inverted repeat of the core Mkx recognition motif.

166 cp genome size is 151,173 bp with a pair of inverted repeats of 27,093 bp separated by small and lar

167 facing conformation with a core structure of inverted repeats of 5 TM helices (TM2 to TM6 and TM7 to

168 retention of mRNA containing in their 3'-UTR inverted repeats of Alu sequences (IRAlu).

169 ane helices, 10 of which are arranged in two inverted repeats of five helices.

170 or a 19-bp motif located within the terminal-inverted repeats of Hsmar1 transposons and their derivat

171 inear elements, at least one of the terminal inverted repeats of pBSSB1 is non-essential, but that a

172 lasts and some bacteria, in that it contains inverted repeats of ribosomal RNA operons.

173 es and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known

174 s been reported for ectopic HR events (e.g., inverted repeats or between plasmids), Rad51 has been th

175 enic lines containing short gene segments in inverted repeat orientation designed to reduce expressio

176 ntly formed by intrachromosomal NAHR between inverted repeat pairs comprising one amplicon on Yp and

177 dominance of GC nucleotides, and presence of inverted repeats (Pr-nucleotides) at processed coding en

178 revealed the presence of AT-rich direct and inverted repeats previously reported to function as DegU

179 An inverted repeat pseudogene can also generate abundant sm

180 ce or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences.

181 The inverted repeats refold to generate Holliday junctions,

182 Both species also had a large inverted repeat region (LIR) of approximately 12 kb, the

183 s that enable insertion of transgenes in the inverted repeat region of the plastome between the trnV

184 w that these two genes, as well as the 77-bp inverted repeat region, are cotranscribed with the capsu

185 Partly because of independent losses of one inverted repeat region, Orobanchaceae plastomes vary 3.5

186 ease-sensitive region that overlaps with the inverted-repeat region of the UEE.

187 lation levels in the internal and terminated inverted repeat regions of these elements, which might b

188 e sequence, termed Heltir, that has terminal inverted repeats resembling Helitron 3' termini.

189 DSB initiates a pairing interaction between inverted repeats, resulting in the formation of large di

190 pulated genetically to express gene-specific inverted-repeat RNA sequences exhibited significant redu

191 , non-canonical promoters consisting of 9 bp inverted repeats separated from a -10 hexamer by 19 bp.

192 of interest: an RNA/DNA hybrid domain and an inverted repeat sequence capable of forming a stem-loop

193 Ser beta-sheet that binds specifically to an inverted repeat sequence distinct from those recognized

194 sin occurred via binding directly to a short inverted repeat sequence in the intergenic region overla

195 v3066 regulator binds to a 14-bp palindromic inverted repeat sequence in the nanomolar range.

196 otein in various genetic backgrounds, and an inverted repeat sequence in the promoter of hetP was nec

197 R binds specifically and tightly to an 11-bp inverted repeat sequence in the promoter regions of the

198 An inverted repeat sequence that overlaps the -10 element o

199 tprinting demonstrated binding of CouR to an inverted repeat sequence that overlaps the -10 region of

200 A similar inverted repeat sequence was identified in the tehA prom

201 sses a single operon by binding to a perfect inverted repeat sequence, whereas HpNikR binds to promot

202 Disruption of an inverted-repeat sequence eliminated DNA secretion, sugge

203 An inverted-repeat sequence located upstream of trpE bound

204 owed in Saccharomyces cerevisiae that nearby inverted repeat sequences ( approximately 20-200 bp of h

205 n integrate both short oligonucleotides with inverted repeat sequences and a 2.8 kb excised mini-casp

206 taining many copies of the viral genome with inverted repeat sequences at the junctions between monom

207 " class of mutations that arise in imperfect inverted repeat sequences by DNA-strand misalignments du

208 Two inverted repeat sequences that represent potential bindi

209 posase binds specifically to ISY100 terminal inverted repeat sequences via an N-terminal DNA-binding

210 ons that self-assemble from single identical inverted-repeat sequences.

211 unique long (UL) region and a segment of the inverted repeat short (IRS)/unique short (US) region.

212 While some Phantom elements have terminal inverted repeats similar in length and structure to Muta

213 Selected repetitive sequences termed short inverted repeats (SIRs) have the propensity to form seco

214 econdary structure consisting of subterminal inverted repeats (SIRs).

215 man miR-29a promoter identified an imperfect inverted repeat spaced by one nucleotide DNA motif, inve

216 of Manduca sexta grew faster when consuming inverted-repeat stable transformants (irAGO8) plants but

217 Its 5' and 3' terminal inverted repeats start with conserved CACTA sequence.

218 The functional relevance of the inverted repeat structure (IR/DR) in a subgroup of the T

219 None of the rearranged sequences showed the inverted repeat structure characteristic of BFB; instead

220 sporters (SLC26Dg and UraA), to have a 7 + 7 inverted repeat structure with anion transport initiated

221 functional relevance of the pseudosymmetric inverted-repeat structures of the antiporter-like subuni

222 o Mutator elements, some display subterminal inverted repeats (sub-TIRs) and others have more complex

223 short ( approximately 30- to 40-nucleotide) inverted repeats, such as Alu elements, are sufficient t

224 nt Repeat Database and searches for flanking inverted repeats suggest that the high incidence of disp

225 amily and a member of the widespread 5-helix inverted repeat superfamily of transporters.

226 Finally, we show that fusion of inverted repeats, surprisingly, does not require genes i

227 Purified YqjI binds inverted repeat target sequences within the yqjH and yqj

228 forms a tetramer, which tightly binds to an inverted-repeat target sequence overlapping with the pro

229 matin at centromeres I and III is flanked by inverted repeats termed IRCs, which are required for pro

230 Defined by a conserved 5-helix inverted repeat that encodes common principles of ion an

231 s of the complete regulon identified a 15 bp inverted repeat that functions as a high-affinity bindin

232 Instead P(m) has a hyphenated inverted repeat that serves as the Mor binding site over

233 entifies a previously unknown pair of 5' UTR inverted repeats that act by altering the relative fimA

234 several homonucleotide runs as well as small inverted repeats that are able to form strong secondary

235 parently a foldback transposon with terminal inverted repeats that are much longer and more complex t

236 epeats is general; we found that many nearby inverted repeats that are present in the yeast genome al

237 Fusion occurs between inverted repeats that are separated by several kilobases

238 d by 6-bp target site duplications, terminal-inverted repeats that are several hundred nucleotides lo

239 e DUP-TRP/INV-DUP structures are mediated by inverted repeats that can be separated by >300 kb, a gen

240 ast, the smaller, but significant, excess of inverted repeats that we report in protein coding sequen

241 ztransib has 3518 bp including a 5' terminal inverted repeat (TIR) of 552 bp, a promoter sequence of

242 TEs) are short DNA transposons with terminal inverted repeat (TIR) signals and have been extensively

243 he transposase activities including terminal inverted repeat (TIR) specific DNA-binding activity, DNA

244 ransposase activities, including 5'-terminal inverted repeat (TIR)-specific binding and assembly of a

245 the transposase domain possesses 5'-terminal inverted repeat (TIR)-specific DNA binding, DNA looping,

246 ucleotide duplexes derived from the terminal inverted repeats (TIR) of the A. boonei casposon as well

247 The P-element 31-bp terminal inverted repeats (TIRs) contain sequences essential for

248 get site duplications and a pair of terminal inverted repeats (TIRs) resembling V(D)J recombination s

249 tion bias toward noncoding regions, terminal inverted repeats (TIRs), target site duplications, and p

250 superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback

251 t core of 10 TMSs is made of two intertwined inverted repeats (TMS1-5 and TMS6-10) that are followed

252 can also be shortened from the native 50-bp inverted repeat to 26 bp; thus, the Agrobacterium hairpi

253 ate faulty template switching between nearby inverted repeats to form dicentric chromosomes.

254 Fusion of nearby inverted repeats to form dicentrics may be a major cause

255 lineate two pathways that spontaneously fuse inverted repeats to generate unstable chromosomal rearra

256 ce with what we observed previously with the inverted repeat ToxT sites between acfA and acfD.

257 ow that this T-DNA configuration produces an inverted repeat transcript and that small interfering RN

258 Finally, gene silencing by an inverted repeat transgene is impaired in upf1-5 mutants,

259 ardtii, sRNAs derived from genome-integrated inverted repeat transgenes, perfectly complementary to t

260 An active miniature inverted repeat transposable element (MITE), mPing, was

261 Miniature inverted repeat transposable elements (MITEs) are preval

262 Miniature inverted repeat transposable elements (MITEs) are preval

263 Miniature inverted repeat transposable elements (MITEs) are widesp

264 arities to archaeon and eukaryotic miniature inverted repeat transposable elements.

265 217 insertions of 18 Stowaway-like miniature inverted-repeat transposable element (MITE) families pre

266 discovery of rice strains where a miniature inverted-repeat transposable element (mPing) has amplifi

267 We found a miniature inverted-repeat transposable element insertion in the pr

268 Miniature inverted-repeat transposable elements (MITEs) are a spec

269 Although miniature inverted-repeat transposable elements (MITEs) are closel

270 Miniature inverted-repeat transposable elements (MITEs) are short

271 Miniature inverted-repeat transposable elements (MITEs) constitute

272 share all the classic features of miniature inverted-repeat transposable elements (MITEs), including

273 riched with the Stowaway family of miniature inverted-repeat transposable elements (MITEs).

274 genome has features in common with miniature inverted-repeat transposable elements (MITEs): high A +

275 Among TEs, miniature inverted-repeat transposable elements are nonautonomous

276 (PEGs), which were associated with miniature inverted-repeat transposable elements, imprinted differe

277 ified ISs, and of hitherto unknown miniature inverted-repeat transposable elements.

278 r molecules centred at kinked helices in two inverted-repeat triple-helix bundles (THBs).

279 high propensity to execute a U-turn at small inverted repeats (up to 1 in 40 replication events).

280 binding site to a region within an imperfect inverted repeat upstream of the -35 region.

281 perates as a conserved rheostat between long inverted repeats upstream of each exon.

282 gions; identified the ISs' possible terminal inverted repeats, usually flanked by direct repeats; and

283 of specific nucleotide sequences, direct and inverted repeats, variable length tandem repeats of subp

284 A DNA motif consisting of an inverted repeat was identified in each of the promoters

285 transcription and a portion of the upstream inverted repeat was required.

286 Breakpoints occurring in the terminal inverted repeats were excluded from analysis to prevent

287 The oriT2 site contains a large inverted repeat (where the nic site is located) adjacent

288 t DNA is 160,149 bp in size with a 21,822-bp inverted repeat, whereas NIES293 (West Pacific) chloropl

289 acterium liquefaciens comprises a five-helix inverted repeat, which is widespread among secondary tra

290 ment and a 73-bp sequence were identified as inverted repeats, which could explain the possible mecha

291 ding sequences they both detect an excess of inverted repeats, which is much lower than previously re

292 ation repair (PRR) pathway prevent fusion of inverted repeats, while genes in the translesion branch

293 two copies of an 11 bp motif arranged as an inverted repeat with 1 bp spacing.

294 tor sites having more than one 5'-TAC/GTA-3' inverted repeat with implications in vivo for a mechanis

295 ally high GC content, each containing a long inverted repeat with one or two protein-coding genes and

296 They are arranged as a pair of inverted repeats with a 2-bp overlap between the repeats

297 ement in chloroplasts is probably limited by inverted repeats with a conserved core region.

298 footprint data in E. coli generally contains inverted repeats with significantly (p < 0.05) greater p

299 uble-stranded DNA binding activities for the inverted repeat within either oriT sequence.

300 specific, imperfect DNA hairpin formed by an inverted repeat within the upstream essential element (U