ライフサイエンスコーパス: measurably

1 rations of carbachol to increase [Ca(2+)](i) measurably.

2 bind with low affinity, and two do not bind measurably.

3 cted in particles and therefore did not bind measurably.

4 l treatment of gaps, ET performance improves measurably.

5 Preterm birth did not measurably accelerate the maturation of the IgA repertoi

6 The Kdm4 proteins did not measurably accumulate at gamma-irradiation-induced gamma

7 old weaker and even 3''-dephospho-AdA (5) is measurably active, despite missing one of the vicinal bi

8 erality of an irradiated breast cancer could measurably affect cardiac mortality and mortality from c

9 of endogenous SA in transgenic rice does not measurably affect defense gene expression, but reduces t

10 ion of the amyloid dye thioflavin T does not measurably affect fibril stability, in contrast to the c

11 impair DNA binding of GATA1 in vitro did not measurably affect in vivo target gene occupancy.

12 The presence of K2 did not measurably affect liposome surface accessibility or lipi

13 concentrations well below those required to measurably affect Met expression or cell proliferation.

14 These results show that base-pairing can measurably affect nonradiative decay pathways in A.T dup

15 st that spatial and temporal variance do not measurably affect the analysis.

16 A photodegradation processes could therefore measurably affect the budgets of both particulate and ga

17 While deletion of the N-terminus does not measurably affect the global structure of the complex, t

18 electrochemical treatment did not appear to measurably affect the noise, longevity, metal adhesion,

19 onfirmed that stimulation with light did not measurably affect the rate of conversion of [3H]histidin

20 MMOR, and the oxidized hydroxylase does not measurably affect the structure of the diiron(III) site.

21 ating, however, NCS-1 co-expression does not measurably affect the voltage dependence of steady-state

22 ect lay between 0.1 and 1 microM and was not measurably affected by cytosolic acidification.

23 t-1 TG mice, and tumor growth rates were not measurably affected by late ovariectomy.

24 HBV transcription was not measurably affected by the absence of the HNF1 alpha tra

25 iting planets, the times of the transits are measurably affected by the gravitational interactions be

26 GTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity.

27 lthough Kv4.3 mRNA/protein expression is not measurably affected, KChIP2 expression is markedly reduc

28 iagnosis and/or treatment of the patient was measurably affected.

29 e-, urea-, and acid-induced denaturation was measurably affected.

30 s and evoked action potential firing without measurably affecting the expression or localization of v

31 y reduced curvature, and the removal of Mg2+ measurably affects bending.

32 inhibition of the Na+-Ca2+ exchanger did not measurably alter the amplitude or decay kinetics of the

33 5-Fluoro substitution does not measurably alter the excitation-induced change in perman

34 s found that vesicular release events do not measurably alter the impedance, but the depolarizing sol

35 S1 antigenemia indicated balapiravir did not measurably alter the kinetics of these virological marke

36 find that ATP depletion in the cell does not measurably alter the parameter, and we thus conclude tha

37 rements show that some of these Gly residues measurably alter the rates of metal ion association and

38 ependently of the CD28/B7 system and was not measurably altered by CD28.

39 v4.3, Kv1.4, Kv2.1, Kv2.2), however, are not measurably altered in Kv4.2-/- cortices.

40 ary structure of the inactive complex is not measurably altered.

41 lower, but ileal mucosal blood flow was not measurably altered; c) lipopolysaccharide-evoked tumor n

42 the aspartate 84 (D-84) mutants studied bind measurably, although they are efficiently incorporated i

43 erence to these protocols is associated with measurably beneficial effects on the psychological healt

44 r infections, pulmonary vaccination provides measurably better protection against pulmonary challenge

45 f life in patients who underwent surgery was measurably better than that of the medical cohort with u

46 While the N-terminal lobe alone does not measurably bind cellular transferrin receptors or serve

47 ne (CQ) with a K(D) near 400 nM but does not measurably bind the related drug quinine (QN) at physiol

48 Isoflurane gas measurably blunted the response to apomorphine, so that

49 mposition of terrestrial sulfate is affected measurably by many Earth-surface processes.

50 ed the affinity for the receptor but did not measurably change peptide selectivity.

51 A study on an antireflux stent will not measurably change the current use of this device, but em

52 ed cleavage of the nascent RNA, but does not measurably change the rates of single nucleotide additio

53 utoinducer-2 [AI-2]) and responds to AI-2 by measurably changing production of several infection-asso

54 tion of the current through the wild type is measurably conducted through R352Q.

55 te ion, 86% of the added peroxynitrite being measurably converted to this species.

56 Ca(2+) influx for mitochondria to influence measurably cytosolic [Ca(2+)] signals under physiologica

57 tly with any single factor, though they were measurably decreased by hydrogen bonding to an E7 glutam

58 risingly, the mutated Imp4 proteins were not measurably defective for interaction with Mpp10p in the

59 cl-2 or bcl-XL transgenes did not prevent or measurably delay photoreceptor degeneration.

60 rocks from Earth and the moon does not vary measurably (delta(56)Fe = 0.0 +/- 0.3 per mil).

61 ed by deprotonation in the 2-position is not measurably deprotonated at equilibrium because the ion i

62 ive forms of eight of the nine variants were measurably destabilized, by 1-7 kcal/mol (1 cal=4.184 J)

63 ndergoes a conformational change, it assumes measurably different conformations.

64 C15) showed disruption of each pathway with measurably different efficiencies and reaction rates.

65 monolayer-protected clusters (MPCs) occur at measurably different electrochemical potentials owing to

66 Atherosclerosis in germ-free animals was not measurably different from that in animals raised with am

67 cteristics of the truncated variant were not measurably different from those of full-length HjLPMO9A,

68 a physical system can simultaneously include measurably different physical states.

69 single donor, exhibit channel activity with measurably different voltage-dependent gating, a finding

70 k-1 of the rUreR-DNA complex interaction was measurably different when urea was present.

71 Prazosin did not measurably displace [3H]CUMI-101 binding in baboon or hu

72 We observe measurably distinct phylogenetic profiles among proteins

73 inding indicate that the pro region does not measurably distort the protease active site.

74 anticodon and extra arm of tRNALeu-1 do not measurably effect its ability to serve as a substrate fo

75 is, senescent dog RBCs were found to contain measurably elevated membrane-bound (denatured) globin an

76 Acylation did not measurably enhance raft association by the first two ass

77 two novel genes (Tcr_0466 and Tcr_2018) was measurably enhanced.

78 greatly improved amyloid nucleation without measurably enhancing beta-structure in the monomer ensem

79 SpeB was not measurably expressed in strains containing covR(WT)/covS

80 mations of the transformed variants differed measurably from transformed plasma alpha2M.

81 endosomes and then into the cytosol, without measurably harming the cells.

82 rmed early and the home learning environment measurably helps shape the lexicon from the outset.

83 preading events, in which an individual with measurably high connectivity is responsible for infectin

84 We find that temporal resolution is measurably higher for each feature than for their conjun

85 The affinity is measurably higher for RanGDP than for RanGTP and varies

86 gun control, whereas individuals displaying measurably higher physiological reactions to those same

87 peroxide production by wild-type FNR-Fld was measurably higher than that generated by FNR-D144A or FN

88 Within the approximately 300-nm region measurably illuminated by the evanescent field resulting

89 ther required for the induction of Tregs nor measurably impact on the extent of their accumulation.

90 and diminishing established disease without measurably impacting general immunocompetence.

91 h could alter the charge of lysines, did not measurably impair DNA translocation or affect the one-wa

92 an increase in O2- of any more than fourfold measurably impaired growth, and a fivefold increase in O

93 ed residues 133 to 136 of the connector loop measurably impaired the UL44-UL54 interaction without al

94 nts with very large cysts, renal function is measurably impaired.

95 mpt insertion of tympanostomy tubes does not measurably improve developmental outcomes at the age of

96 movements only at (slower) speeds where they measurably improve performance.

97 owed that the use of more precise input data measurably improves the local precision and accuracy of

98 leukemia virus reverse transcriptase did not measurably incorporate the analogues, this enzyme bound

99 terenol, at a concentration of 1 nm, did not measurably increase intracellular cyclic adenosine monop

100 in with the NADPH-FAD subdomain but does not measurably increase its interaction with the oxygenase d

101 d spontaneous AP firing (<2 min) and did not measurably increase synaptic activity.

102 he use of PPIs in clinical practice does not measurably increase the risk of CRC.

103 cal testing before cataract surgery does not measurably increase the safety of the surgery.

104 to be very unstable, however, the stability measurably increased after 24-48 h of activation.

105 our of delay in initiating effective therapy measurably increases patient mortality.

106 with vimentin intermediate filaments (VIFs) measurably increases their membrane potential.

107 nd PBTSA3T, but less efficiently, reflecting measurably inferior morphology and nonoptimal energy lev

108 the vast majority of hexamer sequence motifs measurably influence splice site selection when position

109 find that the FRAP bleach intensity does not measurably influence the diffusion in the samples, but t

110 save many lives in West Africa but will not measurably influence the prevalence.

111 Torques exerted by sublimation measurably influence the spin rates of active comets and

112 ibodies raised against DNA ligase IV did not measurably inhibit end joining at 10 mM Mg(2+) in either

113 Because the phosphonate analogues measurably inhibited e-N (apparent Ki values of 6-12 mic

114 complete picture of the many components that measurably interact in a network manner to produce cellu

115 PD-L1, TGF-beta, and CTLA-2alpha were not measurably involved in RPE cell-induced MDSC differentia

116 group results in less steric interaction and measurably larger electron proton coupling constants.

117 mmadelta T cells (C57BL/6-derived) developed measurably less disease compared with untreated mice.

118 and bilaterality of AMD are associated with measurably lower HRQoL scores, with the largest differen

119 h strong political beliefs, individuals with measurably lower physical sensitivities to sudden noises

120 nterpart and the stability of metFixL*-CN is measurably lower than that of metFixLN-CN.

121 transcripts, and produces annotation that is measurably more accurate than some evidence-based gene s

122 However, the 1999 isolate was measurably more cytotoxic to CD4(+) T cells than the 199

123 ntained interfibrillar reflections that were measurably more diffuse, a fact that points to a widespr

124 n years ago, archaebacterial sequences being measurably more similar to eukaryotic ones than are euba

125 linkage region, formed RNA dimers that were measurably more stable than WT.

126 Our numerical results predict a measurably nonlinear force-deflection behavior at modera

127 ociation between beta-catenin and c-Neu that measurably occurs only in neoplasia, most strongly in me

128 , and the light-sensitive conductance is not measurably permeable to Ca2+.

129 oocytes, but we find that these channels are measurably permeable to Na2+ and Ca2+.

130 They do not measurably perturb sex chromosome segregation, suggestin

131 ariable under physiologic conditions, and is measurably prolonged by many drugs.

132 yclin/p53(-/-) lymphocytes in vitro were not measurably protected from DNA damage-induced apoptosis c

133 a selective COX-1 inhibitor, SC-560, did not measurably reduce tumor prostaglandin levels or tumor gr

134 hesion molecule-1 (ICAM-1) expression is not measurably reduced by either cell type under the same co

135 e-associated alpha-crystallin complexes have measurably reduced CLA compared to complexes in solution

136 transport nor cerebral glucose metabolism is measurably reduced in people with poorly controlled type

137 IL-4-induced CD23 expression was measurably reduced in the CD20- population as well.

138 Rab9 can measurably reverse SifA-dependent LAMP1 recruitment and

139 brations of deoxyFixLN and deoxyFixL are not measurably shifted from those of their neutral counterpa

140 ibrational dephasing of the heme-bound CO is measurably slower for both MbCO and HbCO relative to tha

141 mal, the subpopulation of DN4 thymocytes was measurably smaller because of reduced proliferation and

142 ilar experimental conditions, SGK displays a measurably stronger inhibitory effect on B-Raf kinase ac

143 It measurably suppressed the interferon antiviral pathway b

144 titutions nor double substitutions increased measurably the extent of FH19-20 self-association, nor d

145 Inhibition of AdSS by 5'-PH was measurably time-dependent.

146 Given that L-type VSCCs do not contribute measurably to Ca2+ influx in spines, they must activate

147 H3, another virus isolate that does not bind measurably to DAF, adaptation to RD cells resulted in a

148 ATA-3(-/-) ES cells are unable to contribute measurably to the double-negative thymocyte population.

149 ly the early multiply spliced transcript was measurably translated.

150 bVMAT substrate tyramine, none of them were measurably transported into the granule.

151 le activity, and most fragments did not bind measurably, until they captured most of the substrate fe

152 Helical content did not change measurably upon photoactivation.

153 strain indicated that the stator-binding was measurably weaker when motors were unable to generate to

154 t1, Ccdc26 and Gsdmc fails to advance cancer measurably, whereas a single supernumerary segment encom

155 orpedo californica AChE, PMSF does not react measurably with the T. californica enzyme.