ライフサイエンスコーパス: oligodeoxyribonucleotide

1 (2) expression by their respective antisense oligodeoxyribonucleotide.

2 otin linkage and annealed to a complementary oligodeoxyribonucleotide.

3 comprised of a G-rich 18-mer triplex forming oligodeoxyribonucleotide.

4 N-acetoxy-PhIP, with a single-stranded 11mer oligodeoxyribonucleotide.

5 tive on the 5'-terminus of the support-bound oligodeoxyribonucleotide.

6 as incorporated into a short single-stranded oligodeoxyribonucleotide.

7 able to repair O6-benzylguanine in a 16-mer oligodeoxyribonucleotide.

8 er and was specifically competed by an Oct-1 oligodeoxyribonucleotide.

9 a cells to a calpain small subunit antisense oligodeoxyribonucleotide.

10 tween fivefold and 27-fold, depending on the oligodeoxyribonucleotide.

11 osphoramidite and used in the preparation of oligodeoxyribonucleotides.

12 ble and nonexchangeable protons for all four oligodeoxyribonucleotides.

13 from formal nucleotide deletion in synthetic oligodeoxyribonucleotides.

14 emolytic complement lysis than do control PS oligodeoxyribonucleotides.

15 such behavior in double- and triple-stranded oligodeoxyribonucleotides.

16 cts the ATPase activity of RecA protein with oligodeoxyribonucleotides.

17 hosphorothioate (PS) and phosphodiester (PO) oligodeoxyribonucleotides.

18 shed by pretreatment with antisense TGFbeta1 oligodeoxyribonucleotides.

19 nity for binding to native DNA and substrate oligodeoxyribonucleotides.

20 ibution, stability and radiotoxicity of 125I-oligodeoxyribonucleotides (125I-ODN) in human fibrosarco

21 Here we describe the use of an oligodeoxyribonucleotide 19mer psoralen-modified TFO to

22 the site-specific placement of 8 in a 12-mer oligodeoxyribonucleotide 26.

23 solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at

24 Oligodeoxyribonucleotides (5'-phosphorylated) of varying

25 Oligodeoxyribonucleotides (5'TCCTCCTG1G2-CCTCTC), modifi

26 Oligodeoxyribonucleotides ((5)(')GAGGTGCG(BPDE)TGTTTGT)

27 Here we synthesize from oligodeoxyribonucleotides a completely de-novo-designed,

28 Oligodeoxyribonucleotides accumulated in the cell nucleu

29 eins adjuvanted with immunostimulatory (CpG) oligodeoxyribonucleotides admixed with either Alhydrogel

30 stranded 8-bromoguanine-containing synthetic oligodeoxyribonucleotide alone and in a duplex construct

31 rotein levels by PKCdelta-specific antisense oligodeoxyribonucleotides also inhibited 15-LO expressio

32 oligomers therefore represent a new class of oligodeoxyribonucleotide analogs having phosphorus- carb

33 n excess amount of a single base substituted oligodeoxyribonucleotide and distinguishes single nucleo

34 ort the synthesis of a novel trithiol-capped oligodeoxyribonucleotide and gold nanoparticle conjugate

35 serve as lateral spacers between neighboring oligodeoxyribonucleotides and as a linker arm between th

36 ct of laminin was reduced by using antisense oligodeoxyribonucleotides and DNA enzymes.

37 ic method was developed for the synthesis of oligodeoxyribonucleotides and oligodeoxyribonucleoside m

38 nD were investigated by using JunD antisense oligodeoxyribonucleotides and transient transfection wit

39 ch as ribozymes, antisense RNA and antisense oligodeoxyribonucleotides, and for optimizing the design

40 complexes formed with 16-, 30-, and 80-base oligodeoxyribonucleotides are 3.8 +/- 0.3, 5.3 +/- 0.2,

41 this prediction showing that antisense junD oligodeoxyribonucleotides are mitogenic for differentiat

42 ion of 5-iodouridine at thymine sites of the oligodeoxyribonucleotide as an additional photoreactive

43 re introduced onto the 5'-end of a synthetic oligodeoxyribonucleotide as the last step of an automate

44 Using a biotinylated homopyrimidine oligodeoxyribonucleotide as third-strand probe, TAC is p

45 bility of RecA protein to hydrolyze UTP with oligodeoxyribonucleotides as cofactor and the ability of

46 sequence was observed using 12-mer synthetic oligodeoxyribonucleotides as substrates and as DNA seque

47 2) protein expression, mediated by antisense oligodeoxyribonucleotides (AS-ODN) specific for cPLA(2)

48 yethoxy (MOE) nucleotides into the antisense oligodeoxyribonucleotide (ASO) of the heteroduplex to al

49 ding small-molecule inhibitors and antisense oligodeoxyribonucleotides (ASON), are undergoing clinica

50 odified nucleotides were introduced into the oligodeoxyribonucleotide at the catalytic site of the he

51 Ribozyme efficacy was first assessed by an oligodeoxyribonucleotide-based assay to identify the mos

52 n of PKC epsilon protein levels by antisense oligodeoxyribonucleotides blocks MAPK activation in resp

53 d from monothiol and cyclic disulfide-capped oligodeoxyribonucleotides, but comparable hybridization

54 gth impurities was isolated from a synthetic oligodeoxyribonucleotide by PAGE and labeled with 35S.

55 arboxamide was incorporated into a series of oligodeoxyribonucleotides by solid-phase phosphoramidite

56 Significantly, this novel trithiol oligodeoxyribonucleotide can be used to stabilize partic

57 that gamma irradiation of a synthetic duplex oligodeoxyribonucleotide can give rise to an intrastrand

58 The nuclease resistance of the oligodeoxyribonucleotides capped with guanidinium linkag

59 isense but not by sense or missense TGFbeta1 oligodeoxyribonucleotides caused essentially complete in

60 ssion of synexin was down-regulated using an oligodeoxyribonucleotide complementary to the synexin mR

61 By using phosphorothioate oligodeoxyribonucleotides complementary to the region of

62 Despite the small footprint, however, oligodeoxyribonucleotides comprising <15 bp with a hypox

63 hyltransferase (M.HhaI), AdoMet and a target oligodeoxyribonucleotide containing 5-fluorocytosine con

64 An oligodeoxyribonucleotide containing a heptane cross-link

65 -l-homocysteine and a double-stranded 13-mer oligodeoxyribonucleotide containing DZCyt at the target

66 8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines wa

67 new method is reported for the synthesis of oligodeoxyribonucleotides containing 2-aminopurine resid

68 Short oligodeoxyribonucleotides containing a central b(6)G are

69 de-induced chemical ligation, four 27-member oligodeoxyribonucleotides containing a pyrophosphate int

70 poration into DNA, we chemically synthesized oligodeoxyribonucleotides containing a single dG(s) (11

71 iazoacetate exposure, and the preparation of oligodeoxyribonucleotides containing a site-specifically

72 sequence context, we used 13 different 25 bp oligodeoxyribonucleotides containing a unique hypoxanthi

73 Oligodeoxyribonucleotides containing CpG dinucleotides (

74 Synthetic oligodeoxyribonucleotides containing CpG-dinucleotides (

75 Oligodeoxyribonucleotides containing DZCyt formed a tigh

76 for antisense therapeutics, we have prepared oligodeoxyribonucleotides containing more than 200 diffe

77 examined whether human AGT could react with oligodeoxyribonucleotides containing multiple b(6)G resi

78 both ATL proteins bind with high affinity to oligodeoxyribonucleotides containing O(6)-alkylguanines

79 as also observed with single-stranded 16-mer oligodeoxyribonucleotides containing O(6)-methylguanine,

80 Oligodeoxyribonucleotides containing pseudorotationally

81 We now show that synthetic oligodeoxyribonucleotides containing the known MGMT subs

82 In order to trap a covalent AGT-DNA complex, oligodeoxyribonucleotides containing the novel nucleosid

83 Oligodeoxyribonucleotides containing the nucleoside anal

84 Oligodeoxyribonucleotides containing thymidine and 8-oxo

85 Oligodeoxyribonucleotides containing unmethylated CpG mo

86 between HhaI methyltransferase (M.HhaI) and oligodeoxyribonucleotides containing ZCyt at the target

87 hat incorporate O(6)-alkylguanine adducts in oligodeoxyribonucleotide contexts.

88 Primers employed in the PCR represented oligodeoxyribonucleotides corresponding to conserved ami

89 Such oligodeoxyribonucleotides could form the basis for the d

90 The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT),

91 The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTC

92 tudies are reported for two nine-residue DNA oligodeoxyribonucleotides, d(CATGGGTAC).d(GTACNCATG) (1)

93 stability and conformation of the antisense oligodeoxyribonucleotides, d[CGCGTT x TTGCGC] [x = phosp

94 ically modified and stereochemically defined oligodeoxyribonucleotides derived from the covalent reac

95 Oligodeoxyribonucleotides designed to block particular t

96 nor hearts with a phosphorothioate antisense oligodeoxyribonucleotide directed against Egr-1 before o

97 onor lungs with a phosphorothioate antisense oligodeoxyribonucleotide directed against the Egr-1 tran

98 Transfecting cortical neurons with antisense oligodeoxyribonucleotides directed against NP1 mRNA (NP1

99 In the case of synthetic oligodeoxyribonucleotide drugs, however, product complex

100 the interactions of NF-kappaB proteins with oligodeoxyribonucleotide duplexes containing kappaB site

101 ame complex was also shown to bind synthetic oligodeoxyribonucleotide duplexes containing the nonnatu

102 stics of bends in site-specifically modified oligodeoxyribonucleotide duplexes induced by single (+)-

103 scarbamylase (OTC) by recursive PCR using 18 oligodeoxyribonucleotides, each 70-80 nucleotides in len

104 de and was attached to the 5'-terminus of an oligodeoxyribonucleotide following a reverse coupling pr

105 interventional phase III trials of antisense oligodeoxyribonucleotides for a cancer indication will b

106 The major hurdle associated with utilizing oligodeoxyribonucleotides for therapeutic purposes is th

107 at could be reversed by removal of antisense oligodeoxyribonucleotide from the culture medium.

108 thesis and triplex stabilizing properties of oligodeoxyribonucleotides functionalized at the 5'- and/

109 cence studies using 2-aminopurine-containing oligodeoxyribonucleotides further revealed the sequentia

110 Single-stranded guanosine-rich oligodeoxyribonucleotides (GROs) have a propensity to fo

111 pacity compared with hypoxanthine-containing oligodeoxyribonucleotides >20 bp in length.

112 cytosine in G-C-G-C sites in double-stranded oligodeoxyribonucleotides had a similar effect on methyl

113 e recombinant human MPG protein from a 39 bp oligodeoxyribonucleotide harboring a unique hypoxanthine

114 Herein, we synthesized oligodeoxyribonucleotides harboring eight site-specifica

115 In the present study, we synthesized oligodeoxyribonucleotides harboring seven O(2)-alkyldT l

116 A novel method for the deprotection of oligodeoxyribonucleotides has been developed.

117 Oligodeoxyribonucleotides have been constructed with the

118 For example, oligodeoxyribonucleotides having a (tert-butyl)phenoxyac

119 ditions, only the perfectly sequence-matched oligodeoxyribonucleotide hybridized to each probe, while

120 etric data indicate that the single-stranded oligodeoxyribonucleotides hydrate very similarly to dupl

121 potent as inhibitors of DNA methylation than oligodeoxyribonucleotides identical in sequence containi

122 en antigen, conjugated to a phosphorothioate oligodeoxyribonucleotide immunostimulatory sequence of D

123 or automated synthesis of double dye-labeled oligodeoxyribonucleotides in high yield.

124 PKCdelta antisense oligodeoxyribonucleotides inhibited the phosphorylation

125 STAT1 and STAT3 transcription factor decoys oligodeoxyribonucleotides into PC12 cells, nicotine indu

126 DNA methyltransferase covalently bound to an oligodeoxyribonucleotide is not efficiently excised by u

127 Attachment of sulfhydryl-terminated oligodeoxyribonucleotides is highly site specific, and i

128 s on spectral bands in these single-stranded oligodeoxyribonucleotides is markedly different from suc

129 Facile modification of oligodeoxyribonucleotides is required for efficient immo

130 The cleavage rate of oligodeoxyribonucleotides is significantly increased by

131 DNA and related synthetic immunostimulatory oligodeoxyribonucleotides (ISS-ODN) stimulate innate imm

132 Immunostimulatory CpG-C oligodeoxyribonucleotides (ISS-ODNs) represent a promisi

133 g., CD40L) and TLRs (e.g., immunostimulatory oligodeoxyribonucleotides (ISS-ODNs)) is crucial for max

134 Incubation of AGT with DBE and oligodeoxyribonucleotides led to the formation of covale

135 e with 1,2-dibromoethane and single-stranded oligodeoxyribonucleotides led to the formation of covale

136 yzed in reactions in which the cofactors are oligodeoxyribonucleotides less than approximately 50 nt

137 We demonstrate that oligodeoxyribonucleotides modified with the correspondin

138 The oligodeoxyribonucleotide-modified surfaces were extremel

139 id duplex formed by a methylphosphonate (MP) oligodeoxyribonucleotide (MPO) and its target oligoribon

140 Uniformly modified oligodeoxyribonucleotide N3'-->P5' phosphoramidates cont

141 f novel nucleic acid analogs, alpha-anomeric oligodeoxyribonucleotide N3'-->P5' phosphoramidates, are

142 dation of 1-methyladenine in poly(dA), short oligodeoxyribonucleotides, nucleotides, and nucleoside t

143 In addition, the microinjection of an oligodeoxyribonucleotide (OD) directed against cat NGF m

144 e marrow and treated with NF-kappaB-specific oligodeoxyribonucleotide (ODN) in vitro (NF-kappaB ODN D

145 ng three different adjuvants showed that CpG oligodeoxyribonucleotide (ODN) induces very low levels o

146 with polyethylene glycol was used to improve oligodeoxyribonucleotide (ODN) loading, stability of the

147 ived a daily injection of TNFalpha antisense oligodeoxyribonucleotide (ODN) or control on days 1 thro

148 esigned and tested prototype NIR fluorescent oligodeoxyribonucleotide (ODN) reporters that can sense

149 Kir6.2 antisense oligodeoxyribonucleotide (ODN) was then administered dai

150 though iPLA(2)beta or cPLA(2)alpha antisense oligodeoxyribonucleotide (ODN)-treated monocytes display

151 e designed a new class of modified antisense oligodeoxyribonucleotides (ODN) consisting of a central

152 ir maturation was arrested by treatment with oligodeoxyribonucleotides (ODN) specifically against nuc

153 dual PKC isoforms, we chose to use antisense oligodeoxyribonucleotides (ODN) to specifically reduce P

154 attractive target for therapy with antisense oligodeoxyribonucleotides (ODN).

155 nthetic polyamines on the conformation of an oligodeoxyribonucleotide (ODN1) harboring the estrogen r

156 hosphodiester (PO) and phosphorothioate (PS) oligodeoxyribonucleotides (ODNs) (21-mer) targeted to th

157 in 15-LO expression, we generated antisense oligodeoxyribonucleotides (ODNs) against Tyk2 and Jak2.

158 Oligodeoxyribonucleotides (ODNs) bearing the reactive ni

159 Guanine (G)-rich oligodeoxyribonucleotides (ODNs) can form undesired comp

160 n containing a tryptophan (Trp) reporter and oligodeoxyribonucleotides (ODNs) containing a fluorescen

161 ch can be blocked by double-stranded "decoy" oligodeoxyribonucleotides (ODNs) containing binding site

162 we have identified partial phosphorothioate oligodeoxyribonucleotides (ODNs) containing C-5 propynyl

163 Synthetic oligodeoxyribonucleotides (ODNs) containing CpG (unmethy

164 Sequencing reactions were conducted with oligodeoxyribonucleotides (ODNs) containing d(Me)isoC an

165 port, for the first time, the preparation of oligodeoxyribonucleotides (ODNs) containing individual d

166 cess for the first time to a wide variety of oligodeoxyribonucleotides (ODNs) containing O6-alkylguan

167 We have synthesised 5'-psoralen linked oligodeoxyribonucleotides (ODNs) containing thymidine (d

168 ense, but not sense, nonsense, or scrambled, oligodeoxyribonucleotides (ODNs) decreased DNA synthesis

169 However, the efficacy of such oligodeoxyribonucleotides (ODNs) depends on efficient in

170 Synthetic oligodeoxyribonucleotides (ODNs) designed to selectively

171 of transduction with high-affinity antisense oligodeoxyribonucleotides (ODNs) designed to target the

172 highest binding affinities, while pyrimidine oligodeoxyribonucleotides (ODNs) did not show appreciabl

173 ted, solid-phase synthesis of mixed backbone oligodeoxyribonucleotides (ODNs) having 1,2,3-triazolylp

174 The biophysical properties of oligodeoxyribonucleotides (ODNs) selectively modified wi

175 ofuranosyl nucleosides)] into antisense (AS) oligodeoxyribonucleotides (ODNs) should greatly improve

176 cultures treated with HSV DNA or HSV-derived oligodeoxyribonucleotides (ODNs) showed strong prolifera

177 e we report the synthesis of phosphotriester oligodeoxyribonucleotides (ODNs) that are stable to the

178 Modified oligodeoxyribonucleotides (ODNs) that have unique hybrid

179 the native, endogenous mRNA is probed using oligodeoxyribonucleotides (ODNs) to identify RNase H-acc

180 lently linked to the 5' or 3' end of several oligodeoxyribonucleotides (ODNs) totally complementary o

181 or the highly efficient chemical ligation of oligodeoxyribonucleotides (ODNs) using cyanogen bromide

182 We have attached racemic CPI to oligodeoxyribonucleotides (ODNs) via a terminal phosphor

183 Oligodeoxyribonucleotides (ODNs) were prepared with 111I

184 tor system using nitrogen mustard-conjugated oligodeoxyribonucleotides (ODNs).

185 l radical (I) in single- and double-stranded oligodeoxyribonucleotides (ODNs).

186 addition of micromolar concentrations of an oligodeoxyribonucleotide of arbitrary sequence to the tu

187 he target strands compared with an all 3'-5'-oligodeoxyribonucleotide of the same sequence and length

188 The oligodeoxyribonucleotides of this hairpin stem-loop arch

189 ated synthesis on 0.2-1.0 micromol scales of oligodeoxyribonucleotides, of length 6-20 bases, contain

190 Using oligodeoxyribonucleotide (oligo) primers based on the se

191 RT-PCR using human cerebral cortex mRNA and oligodeoxyribonucleotide (oligo) primers derived from th

192 Following Edman degradation, three 17-mer oligodeoxyribonucleotide (oligo) probes corresponding to

193 A wild type oligodeoxyribonucleotide (oligo) spanning the mouse alph

194 that the nuclear factor binding to the FP160 oligodeoxyribonucleotide (oligo) was competed by oligos

195 The potential of guanine-rich oligodeoxyribonucleotides (oligos) as nucleic acid drugs

196 edure for generating long primers from short oligodeoxyribonucleotides (oligos) to incorporate DNA cr

197 Double-stranded (ds) oligodeoxyribonucleotides (oligos) were immobilized in 9

198 ichia coli RNA polymerase of single-stranded oligodeoxyribonucleotides (oligos) with the sequence of

199 HER2/neu-specific phosphorothioate antisense oligodeoxyribonucleotides on HER2/neu expression, tumor

200 when incubated with a mixture of two 16-mer oligodeoxyribonucleotides, one containing O6-benzylguani

201 ynthesis and biophysical characterization of oligodeoxyribonucleotides (ONs) modified with 2'-amino-a

202 For example, oligodeoxyribonucleotides (ONs) modified with 2'-O-(coro

203 dites were synthesized and incorporated into oligodeoxyribonucleotides (ONs), which were then charact

204 oieties and incorporated these monomers into oligodeoxyribonucleotides (ONs).

205 ansferases to generate unique DPC adducts in oligodeoxyribonucleotides or plasmids to monitor both in

206 biological origin, such as oligopeptides and oligodeoxyribonucleotides, or with intact native protein

207 Dicer-substrate siRNAs equipped with CpG oligodeoxyribonucleotides overcome the major hurdle in c

208 Homopurine (AG) and homopyrimidine (CT) oligodeoxyribonucleotides predicted to form triple-helic

209 ted from an 18-nucleotide (nt) oligoribo- or oligodeoxyribonucleotide primer complementary to the pri

210 (KF) as a model proofreading polymerase and oligodeoxyribonucleotide primer/templates as model DNA s

211 microorganisms in clinical specimens employ oligodeoxyribonucleotide primers and probes for specific

212 lification method utilizing a circularizable oligodeoxyribonucleotide probe (C-probe).

213 the synthesis of a radioactive, photolabile oligodeoxyribonucleotide probe and its exploitation in i

214 the synthesis of a radioactive, photolabile oligodeoxyribonucleotide probe and its exploitation in i

215 te constants and thermodynamic affinities of oligodeoxyribonucleotide probes binding to simple synthe

216 The assay utilizes oligodeoxyribonucleotide probes labeled with a highly ch

217 A complete series of oligodeoxyribonucleotide probes were designed, each comp

218 yuridine in both single- and double-stranded oligodeoxyribonucleotides provided much better substrate

219 ing gene-specific antisense phosphorothioate oligodeoxyribonucleotides (PS-ODNs) by the addition of 5

220 specific antisense phosphorothioate-modified oligodeoxyribonucleotides (PS-ODNs) targeting different

221 dicals, G(-H)* in single- or double-stranded oligodeoxyribonucleotides (rate constant of 4.7 +/- 1.0

222 '-5'-ribonucleoside incorporation into 3'-5'-oligodeoxyribonucleotides reduces binding to the target

223 e preparation of phosphorothioate-containing oligodeoxyribonucleotides rely on the reaction of phosph

224 Analysis of MPG protein binding to the 39 bp oligodeoxyribonucleotide revealed that the apparent diss

225 We have developed a system to carry out oligodeoxyribonucleotide-RNA and ribozyme-RNA binding ex

226 ybridization with antisense phosphorothioate oligodeoxyribonucleotides (S-DNAs).

227 g site incorporated within a double-stranded oligodeoxyribonucleotide sequence even in the presence o

228 r, the nature of the protein domain, and the oligodeoxyribonucleotide sequences flanking the platinat

229 Four self-complementary oligodeoxyribonucleotide sequences were prepared and stu

230 th, double-stranded, hypoxanthine-containing oligodeoxyribonucleotides show that the footprinted regi

231 re, by transfecting monocytes with the decoy oligodeoxyribonucleotides specific for Egr-1 and CREB, w

232 ecific molecularly imprinted single-stranded oligodeoxyribonucleotide (ss-ODN) biosensor was fabricat

233 talytic turnover using a hydrolyzable duplex oligodeoxyribonucleotide substrate containing a uracil:2

234 enced by the stoichiometric reaction with an oligodeoxyribonucleotide substrate.

235 , together with the preparation of authentic oligodeoxyribonucleotide substrates housing these two le

236 otides of single-stranded or double-stranded oligodeoxyribonucleotide substrates led to complete inhi

237 Model oligodeoxyribonucleotide substrates representing viral D

238 talyzed reaction with small, single-stranded oligodeoxyribonucleotide substrates under single-turnove

239 Human triplex-forming oligodeoxyribonucleotide (TFO) formed stable triplexes e

240 active group conjugated to a triplex forming oligodeoxyribonucleotide (TFO) that binds in the major g

241 e within a mammalian gene, a triplex-forming oligodeoxyribonucleotide (TFO) that binds with high affi

242 Synthetic triple helix-forming oligodeoxyribonucleotides (TFOs) have been used to alter

243 To explore the ability of triplex-forming oligodeoxyribonucleotides (TFOs) to inhibit genes respon

244 substituent, adamantylcarbamoyl, yielded an oligodeoxyribonucleotide that dissociated with a T m of

245 The thrombin aptamer is a 15-mer oligodeoxyribonucleotide that folds into a unimolecular

246 backbone on the reactions of cisplatin with oligodeoxyribonucleotides that lack or contain a GTG seq

247 that endo VIII removes from double-stranded oligodeoxyribonucleotides the stable oxidative products

248 sequence d(TG)n than with any homopolymeric oligodeoxyribonucleotide; thus, it shows a strong sequen

249 tracerebroventricular injection of antisense oligodeoxyribonucleotide to Kv1.1 reduces expression of

250 th specific antibodies showed that antisense oligodeoxyribonucleotide to Kv1.4 microinjected intraven

251 Binding of the labeled oligodeoxyribonucleotide to the beads was indicative of

252 e, when M21 cells transfected with antisense oligodeoxyribonucleotide to the hnRNP L RNA-binding site

253 chemistry with subunit-specific 35S-labelled oligodeoxyribonucleotides to examine these mRNAs in adul

254 microtiter-based assay to measure binding of oligodeoxyribonucleotides to nucleic acid targets.

255 Using antisense oligodeoxyribonucleotide treatment we found that iPLA(2)

256 duplex DNA sequence recognized by a G/T-rich oligodeoxyribonucleotide under conditions favoring purin

257 accuracy was adequate to verify sequences of oligodeoxyribonucleotides up to 9500-Da molecular mass.

258 mino groups can be coupled to thiol-modified oligodeoxyribonucleotides using a heterobifunctional cro

259 e of the phosphodiester linkage by NaOH, the oligodeoxyribonucleotide was attached to streptavidin-co

260 The oligodeoxyribonucleotide was labeled at the 5' end with

261 The 35S signal intensity of the bound oligodeoxyribonucleotide was proportional to the concent

262 ed phosphonoacetate and thiophosphonoacetate oligodeoxyribonucleotides were chemically synthesized an

263 thods for controlling the surface density of oligodeoxyribonucleotides were explored: in the first, b

264 Phosphonoformate oligodeoxyribonucleotides were prepared via a solid phas

265 ected with 9-fluorenylmethyloxycarbonyl, and oligodeoxyribonucleotides were synthesized on controlled

266 Small oligodeoxyribonucleotides were used as DNA cofactors in

267 ical inhibitors, PKCdelta-specific antisense oligodeoxyribonucleotides were used.

268 This report presents an oligodeoxyribonucleotide which contains a hairpin stem-l

269 e this process, pDCs were activated with CpG oligodeoxyribonucleotides, which stimulated the secretio

270 However, an oligodeoxyribonucleotide with a butane cross-link was a

271 nting experiments with the MPG protein on an oligodeoxyribonucleotide with a unique hypoxanthine at a

272 The substrate used was an oligodeoxyribonucleotide with a unique hypoxanthine base

273 utarate Fe(II) dioxygenase activity using an oligodeoxyribonucleotide with a unique modification show

274 ibition comparable with that of a control PS oligodeoxyribonucleotide with all 3'-5'linkages.

275 sidue is easily verified by treatment of the oligodeoxyribonucleotide with hot piperidine.

276 The corresponding oligodeoxyribonucleotides with 3-nitropyrrole in the sam

277 Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide reve

278 The corresponding oligodeoxyribonucleotides with dI or dA in the same posi

279 ome commonly used fluorophores conjugated to oligodeoxyribonucleotides with different primary and sec

280 bles successful incorporation of SP TpT into oligodeoxyribonucleotides with high efficiency via stand

281 mide moiety, was incorporated into synthetic oligodeoxyribonucleotides with the use of a benzoyl prot

282 -benzyl or -methyl groups when present in an oligodeoxyribonucleotide without altering the reaction w

283 for cleavage and deprotection of dye-labeled oligodeoxyribonucleotides without any degradation or mod