ライフサイエンスコーパス: phosphorothioate

1 rophenyl phosphate and diethyl p-nitrophenyl phosphorothioate.

2 otide: 1), [Rp]-phosphorothioate or 2), [Sp]-phosphorothioate.

3 Cl2(*-) with the model compound diisopropyl phosphorothioate.

4 e morpholino oligomers (PMO) and 2'-O-methyl phosphorothioate.

5 ar precursor containing a 5'-iodide and a 3'-phosphorothioate.

6 microm), Rp-cAMPS (Rp-adenosine cyclic 3',5'-phosphorothioate) (100 microm), or PKI (100 microm).

7 lial cell apoptosis, Bcl-2/Bcl-X(L) chimeric phosphorothioated 2'-MOE-modified antisense oligonucleot

8 ne's mRNA in human leukemia cells with fully phosphorothioated 2'F-ANA-DNA chimeras (PS-2'FANA-DNA) a

9 eous disruption of both proteins using novel phosphorothioate-2'-O-methoxyethyl antisense oligodeoxyn

10 onality of 2'-O-methyl (2Me) and 2'-O-methyl-phosphorothioate (2MePS) MBs.

11 constructs, 2'-O-methyl-1-allylinosinic acid phosphorothioate 33-mer (16) and an oligomer incorporati

12 es with lateral spacers strands comprised of phosphorothioated adenine nucleotides (A15*).

13 Finally, phosphorothioated analogs S-C5 and S-C6 were synthesized

14 n, the thio effect of the S(P)-isomer of the phosphorothioate analogue (k(O)/k(Sp) = 4.4 x 10(5)) app

15 bridging position of the S(p) isomer of the phosphorothioate analogue causes a dramatic (2 x 10(5)-f

16 synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of comme

17 istent trend of a greater DeltaH(++) for the phosphorothioate analogue was found in all three classes

18 tion, hydrolysis of the diastereomers of the phosphorothioate analogues of 1,6-IcP, inositol cis-1,6-

19 Biostable phosphorothioate analogues of 2-5A were synthesized chem

20 hatidic acid (LBPA), bisether analogues, and phosphorothioate analogues of LBPA from solketal.

21 onate, 3-(monofluoromethyl)phosphonate and 3-phosphorothioate analogues of PtdIns(3)P.

22 The corresponding phosphorothioate analogues were obtained by oxidation wi

23 ng group in phosphates, as compared to their phosphorothioate analogues, ruling this out as a contrib

24 Phosphorothioates, analogues of phosphate esters in whic

25 early 4 A decrease in the separation between phosphorothioate and 2'F labels incorporated at A27 in t

26 s, affords two distinct products, inositol 1-phosphorothioate and inositol 6-phosphorothioate, respec

27 ite-specific 2'-deoxynucleotides, as well as phosphorothioate and methylphosphonate modifications wit

28 We find that the phosphorothioate and mixed DNA/2'-O-methyl analogues are

29 An efficient process for purification of phosphorothioate and native DNA sequences is described h

30 In the comparative hydrolysis reactions of phosphorothioate and phosphate esters, the sulfur substi

31 iester, phosphorothioate, and both linkages (phosphorothioate and phosphodiester) present in the same

32 amines the rates and products of cleavage of phosphorothioate and phosphorodithioate analogues of PI

33 ically injected 2'-O-methoxyethyl (2'-O-MOE)-phosphorothioate and PNA-4K oligomers (peptide nucleic a

34 ent equivalency of the transition states for phosphorothioate and sulfate hydrolysis reactions at the

35 framework has led to analogs such as the DNA phosphorothioates and 4'-thio RNA.

36 ed, at the scissile phosphate, with isomeric phosphorothioates and a 3'-phosphorothiolate.

37 bases were synthesized with phosphodiester, phosphorothioate, and both linkages (phosphorothioate an

38 itrophenyl phosphate and ethyl p-nitrophenyl phosphorothioate, and the triesters, diethyl p-nitrophen

39 are observed by treating donor hearts with a phosphorothioate antisense oligodeoxyribonucleotide dire

40 rization of a 5' conjugate between a 2'-O-Me phosphorothioate antisense oligonucleotide and a bivalen

41 A topically applied phosphorothioate antisense oligonucleotide targeted to i

42 G3139, an 18-mer phosphorothioate antisense oligonucleotide targeted to t

43 virsen is a locked nucleic acid-modified DNA phosphorothioate antisense oligonucleotide that sequeste

44 acy and safety of drisapersen, a 2'-O-methyl-phosphorothioate antisense oligonucleotide, given for 48

45 Herein, 2'-O-(2-methoxy)ethyl-modified phosphorothioate antisense oligonucleotides (ASOs) speci

46 Fully phosphorothioate antisense oligonucleotides (ASOs) with

47 ras-1 (KSR1) gene by continuous infusion of phosphorothioate antisense oligonucleotides (ODNs) preve

48 To test this hypothesis, we developed phosphorothioate antisense oligonucleotides that efficie

49 muscular injection of a specific 2'-O-methyl phosphorothioate antisense oligoribonucleotide (2OMeAO).

50 stering oblimersen sodium (G3139), an 18-mer phosphorothioate antisense to Bcl-2, during induction an

51 RALBP1 depletion by phosphorothioate antisense was confirmed and was associa

52 Phosphorothioated antisense (AS) or sense oligonucleotid

53 With the use of a phosphorothioated antisense oligodeoxynucleotide (ODN) t

54 pression of Abcc8, which encodes for SUR1 by phosphorothioated antisense oligodeoxynucleotide essenti

55 Nuclease-resistant phosphorothioated antisense oligonucleotides have been t

56 Conversely, depletion of Notch-1 with phosphorothioated antisense oligonucleotides, correspond

57 transfection protocol with a 2-O-methylated phosphorothioated antisense oligoribonucleotide (2OMeAO)

58 pe 2 diabetes using 2'-methoxyethyl-modified phosphorothioate-antisense oligonucleotide (ASO) inhibit

59 rted the in vitro combinatorial selection of phosphorothioate aptamers or "thioaptamers" targeting th

60 Antisense oligonucleotides linked by phosphorothioates are an important class of therapeutics

61 The phosphorothioates are excellent mimics of DNA, exhibit i

62 This is accomplished by using sodium phosphorothioates as an additive.

63 gnificant role in the uptake of unconjugated phosphorothioate ASOs into hepatocytes.

64 More flexible labels attached to phosphorothioates at the end of the lower stem tumbled i

65 , a diagnostic fragment originating from the phosphorothioate backbone (O2PS-: m/z 94.936) was formed

66 nucleic acids (LNA) AMOs synthesized with a phosphorothioate backbone also inhibited TLR7 sensing in

67 nucleotide [INH-ODN]) are characterized by a phosphorothioate backbone and a CC(T)XXX(3)(-)(5)GGG mot

68 ynthesized with 2' sugar modifications and a phosphorothioate backbone in a mouse model of melanoma l

69 ion that rely on oligomers with phosphate or phosphorothioate backbone linkages.

70 present a unique LC/MS/MS assay for a model phosphorothioate backbone oligodeoxynucleotide (ODN) dru

71 an efficient and cost-effective manner, to a phosphorothioate backbone position at arbitrary DNA or R

72 mixed bacterial vaccine and were shown to be phosphorothioate backbone specific.

73 composed of 2'-O-methyl-modified bases on a phosphorothioate backbone to treat cultured primary myob

74 olecular properties of the lipid moiety, the phosphorothioate backbone, and the presence of triplet-G

75 Inhibition was dependent on A151's phosphorothioate backbone, whereas substitution of the g

76 the sequence, and the activity to require a phosphorothioate backbone.

77 nse, Genta, Berkeley Heights, NJ), an 18-mer phosphorothioate Bcl-2 antisense, with fludarabine (FL),

78 -ASOs in distinct nuclear structures, termed phosphorothioate bodies or PS-bodies.

79 The phosphorothioate bonds modified on a wild-type (WT) spec

80 sitions are predicted to be within ~8 A of a phosphorothioate-bound Pt(II) metal center.

81 ted that synthetic CpG-ODN requires backbone phosphorothioate but not TLR9 activation to render and m

82 ic HNA 'gapmer' oligonucleotide comprising a phosphorothioate central sequence flanked by 5' and 3' H

83 of various MWs and ONs of phosphodiester and phosphorothioate chemistries.

84 The activity of rODNs is phosphorothioate chemistry and G stretch dependent but T

85 In phosphorothioate-containing dsDNA oligomers (S-oligomers

86 Using HJs containing non-cleavable phosphorothioate-containing linkages in one strand, we s

87 The stereoselectivity of phosphorothioate-containing substrates indicated that th

88 A single-stranded phosphorothioate derivative inhibits DNA methylation act

89 table nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-b

90 The two phosphorothioate diastereomers (R(p) or S(p)) were separ

91 rpart pNPP, while alkaline hydrolysis of the phosphorothioate diester and triester exhibits somewhat

92 tly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.

93 any DNA nucleobases and do not desulfurize a phosphorothioate diester model under conditions mimickin

94 cted 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating

95 The resulting phosphorothioate diesters are then substantially desulfu

96 different phosphate diester orientations and phosphorothioate diesters highlight that the interpretat

97 The absolute configurations of phosphorothioate diesters, H-phosphonate diesters, and o

98 tion has been achieved via backbone-modified phosphorothioate DNA and biotin- and maleimide-containin

99 Phosphorothioated DNase I antisense oligodeoxynucleotide

100 It also formed complexes with one phosphorothioate-duplex and one oxyester-duplex but, whe

101 A 100-fold stereospecific phosphorothioate effect at the scissile phosphate is con

102 the scissile phosphate blocks cleavage; the phosphorothioate effect can be rescued by the thiophilic

103 t was possible to determine that the maximal phosphorothioate effect in this system is in the range o

104 Systemic administration of phosphorothioated EGFR antisense oligonucleotides for 30

105 hat obtained previously for a series of aryl phosphorothioate ester dianion substrates.

106 occurs spontaneously when their phosphate or phosphorothioate esters are formed during oligonucleotid

107 Phosphorothioate esters are phosphate esters in which on

108 Phosphorothioate esters are sometimes used as surrogates

109 lysis rates of the dianions of phosphate and phosphorothioate esters are substantially accelerated by

110 edge, the Cu-catalyzed allylic alkylation of phosphorothioate esters has never been described.

111 rium and kinetic isotope effects for several phosphorothioate esters of p-nitrophenol (pNPPT) and com

112 Cu(I) catalyzes the allylic substitution of phosphorothioate esters with excellent alpha-regioselect

113 ferent K(m) values for phosphate compared to phosphorothioate esters.

114 tion of a single phosphodiester group with a phosphorothioate, followed by selective functionalizatio

115 RNA and rRNA binding sites appear different, phosphorothioate footprinting of the L4-RNA complexes re

116 were obtained with locked nucleic acid (LNA) phosphorothioate gap-mers.

117 e HNA antisense oligonucleotide (lacking the phosphorothioate 'gap') was ineffective, indicating that

118 eotides and to a 2'-O-methoxyethyl (2'-O-ME) phosphorothioate 'gapmer'.

119 inase was used to enzymatically substitute a phosphorothioate group at the 5' terminus of a nucleic a

120 odifications moderated the propensity of the phosphorothioate group to bind tightly to the g5p.

121 ed DNA featuring a hydrophobic belt of ethyl phosphorothioate groups insert into bilayer membranes an

122 de bonding between Cys residues and internal phosphorothioate groups of synthetic CpG.

123 Cytosine-phosphorothioate-guanine oligodeoxynucleotides (CpG ODNs

124 Cytosine-phosphorothioate-guanine oligodeoxynucleotides (CpGs) ar

125 e receptor-9 (TLR-9) vaccines using cytosine phosphorothioate guanosine (CpG)-allergen conjugates, an

126 ligomer length-dependent, and the ability of phosphorothioate homopolymers of thymidine of variable l

127 ients for AP-catalyzed aryl sulfate and aryl phosphorothioate hydrolysis (-0.76 +/- 0.14 and -0.77 +/

128 With AT S-oligomers with a single phosphorothioate, i.e., d[ATTTAsAAT]2, reduced levels of

129 In AT S-oligomers with multiple phosphorothioates, i.e., d[ATATAsTsAsT]2, -P-S-Cl reacts

130 Moreover, a single phosphorothioate in place of the scissile phosphate bloc

131 Mouse erythroleukemia cells treated with the phosphorothioate inhibitor show a significant decrease i

132 Using phosphorothioate interference with RNA activity and stru

133 ional switching assay was used to select for phosphorothioate interference, and identifies potential

134 ant MB containing 2'-O-methyl RNA bases with phosphorothioate internucleotide linkages was designed t

135 Formation of inositol 6-phosphorothioate is explained by the binding of trans-1,

136 Stereochemical analysis, using the R(p) phosphorothioate isomer, indicates that Vsr carries out

137 (R,R) and (S,S) enantiomers of both LBPA and phosphorothioate LBPA were synthesized from (S)- and (R)

138 cted metal coordination to both 2'-NH(2) and phosphorothioate ligands.

139 s containing tetrahydrofuran (THF) with a 5'-phosphorothioate linkage as the abasic site substrate.

140 ed to the DNA by a phosphodiester (but not a phosphorothioate) linkage.

141 either phosphodiester or varying numbers of phosphorothioate linkages are remarkably stable during p

142 agging strand of DNA replication, or whether phosphorothioate linkages are used at either end.

143 nition sequence but with either R(p) or S(p) phosphorothioate linkages at the scissile bonds.

144 anded DNA as a substrate and digests through phosphorothioate linkages having one absolute stereochem

145 The use of DNA polymerases to incorporate phosphorothioate linkages into DNA, and the use of exonu

146 atment of cells with RNA duplexes containing phosphorothioate linkages leads to selective inhibition

147 Finally, by using phosphorothioate linkages to protect the lagging-targeti

148 or two 2'-fluoro-2'-deoxyriboses and/or bis-phosphorothioate linkages, are more potent than 2',3'-cG

149 ouble-stranded DNA substrates terminating in phosphorothioate linkages, we suggest that the rate of t

150 acid as a substrate and stops completely at phosphorothioate linkages.

151 same DNA oligomer sequences containing only phosphorothioate linkages.

152 t interfering RNA containing 2'-O-methyl and phosphorothioate linkages.

153 ased immune adjuvants to plasmid by 'hybrid' phosphorothioate-LNA ODNs induces tumour necrosis factor

154 the muscle of mdx mouse through a 2'O-methyl phosphorothioate-mediated splicing modulation.

155 taining a single radioactive phosphate and a phosphorothioate modification at the cleavage site.

156 Using both 3' end phosphorothioate modification of primers and DNA polymer

157 e effective than siRNAs with the widely used phosphorothioate modification.

158 -OH (RNA) groups, alone or combined with the phosphorothioate modification.

159 By placing phosphorothioate modifications at multiple positions of

160 Even minor phosphorothioate modifications can impair the copying pr

161 positions of DNA sequences or by introducing phosphorothioate modifications in the DNA.

162 demonstrate that antagomirs harbor optimized phosphorothioate modifications, require >19-nt length fo

163 arget (5ECdsRan) as a control, was partially phosphorothioate modified and tagged with superparamagne

164 to play a role in the uptake of unconjugated phosphorothioate modified ASOs in the liver as evidenced

165 Here we report that transfected 20-mer phosphorothioate-modified (PS) antisense oligonucleotide

166 growth factors, we characterized a specific phosphorothioate-modified 21-mer antisense PKCalpha (AS-

167 evaluated, we determined that a 2'-O-methyl phosphorothioate-modified anti-miR-221 oligonucleotide w

168 Nusinersen is a 2'-O-methoxyethyl phosphorothioate-modified antisense drug being developed

169 ntified a potent 2'-O-(2-methoxyethyl) (MOE) phosphorothioate-modified antisense oligonucleotide (ASO

170 ting EGFR via intratumoral administration of phosphorothioate-modified antisense oligonucleotides has

171 Our results demonstrate that phosphorothioate-modified ASOs bind a set of cellular pr

172 e contained an arylazido moiety coupled to a phosphorothioate-modified backbone of an oligonucleotide

173 We designed phosphorothioate-modified DNA probes linked to superpara

174 apeutic mechanisms of systemically delivered phosphorothioate-modified EGFR antisense oligonucleotide

175 re composed of 2'-O-methyl RNAs with a fully phosphorothioate-modified loop domain (2Me/PSLOOP MBs),

176 agnetic iron oxide nanoparticles (SPIONs) to phosphorothioate-modified micro-DNA that targets actin o

177 age, the addition of 2'-O-methyl groups to a phosphorothioate-modified ODN is advantageous because of

178 ntisense effects of two types of 20mer ODNs, phosphorothioate-modified ODNs (S-ODNs) and S-ODNs with

179 PION, a T2 susceptibility agent) linked to a phosphorothioate-modified oligodeoxynucleotide (sODN) co

180 e exposure using antisense (AS) or sense (S) phosphorothioate-modified oligodeoxynucleotide (sODN) se

181 short DNA that targets mmp-9 mRNA activity [phosphorothioate-modified oligodeoxynucleotide (sODN)-mm

182 otides, a methylated oligodeoxynucleotide, a phosphorothioate-modified oligodeoxynucleotide, and an e

183 n oxide nanoparticles (SPIONs) (15-20 nm) to phosphorothioate-modified oligodeoxynucleotides (sODNs)

184 ed the effect of sequence-specific antisense phosphorothioate-modified oligodeoxyribonucleotides (PS-

185 Here, we use antisense phosphorothioate-modified oligonucleotides and the host-

186 llected from more than 1000 experiments with phosphorothioate-modified oligonucleotides revealed that

187 erentiation step, antisense inhibition using phosphorothioate-modified oligonucleotides, and overexpr

188 tions occurred even without incorporation of phosphorothioate moieties into the RNA and DNA target mo

189 eptible to fragmentation at sites containing phosphorothioate moieties, labeling and cleavage reactio

190 g(2+) was added to the hybrid complexes, the phosphorothioate moiety at one DNA-binding cleft prevent

191 tes, resulting in a lower DeltaG(++) for the phosphorothioate monoester.

192 ly perturbed through random incorporation of phosphorothioate nucleotide analogues, and RNA molecules

193 therapeutic benefit in treating sepsis with phosphorothioate ODN sequences containing the CpG motif.

194 by treatment with antisense hCG/LH receptor phosphorothioate oligodeoxynucleotide.

195 developed for the quantitation of antisense phosphorothioate oligodeoxynucleotides in plasma using a

196 Antisense phosphorothioate oligodeoxynucleotides were used to degr

197 Furthermore, phosphorothioated oligodeoxynucleotides were found to an

198 1, a ragweed-pollen antigen, conjugated to a phosphorothioate oligodeoxyribonucleotide immunostimulat

199 fficacy of modifying gene-specific antisense phosphorothioate oligodeoxyribonucleotides (PS-ODNs) by

200 molecules used in these studies consisted of phosphorothioate oligomers linked to the Antennapedia (A

201 The phosphorothioate oligonucleotide 'gapmers', with 2'-O-DM

202 poteichoic acid (LTA), thymidine homopolymer phosphorothioate oligonucleotide [Poly(dT)], and polyino

203 letion of DNA methyltransferase 1 (DNMT1) by phosphorothioate oligonucleotide antisense (DNMT1 AS) we

204 mice with locked nucleic acid (LNA)-modified phosphorothioate oligonucleotide complementary to miR 14

205 suppression by G3139 (oblimersen sodium), a phosphorothioate oligonucleotide complementary to the bc

206 d for their gene, mRNA, siRNA and 2'O-methyl phosphorothioate oligonucleotide in vitro transfection a

207 gapmer was substantially more potent than a phosphorothioate oligonucleotide of the same sequence in

208 o test this hypothesis, we used an antisense phosphorothioate oligonucleotide to effect a 50% reducti

209 ve investigated the antiviral mechanism of a phosphorothioate oligonucleotide, ISIS 5652, which has a

210 antisense chimeric 2'-O-(2-methoxy)ethyl/DNA phosphorothioate oligonucleotides (ONs) to affect cell g

211 re systems were used to study the effects of phosphorothioate oligonucleotides (PS-ONs), as amphipath

212 Phosphorothioate oligonucleotides (S-ODNs) or phosphorod

213 d by 5' and 3' HNA sequences to conventional phosphorothioate oligonucleotides and to a 2'-O-methoxye

214 we report that transfection of 2'-F-modified phosphorothioate oligonucleotides into cells can reduce

215 on of RLIP76 using either siRNA or antisense phosphorothioate oligonucleotides preferentially caused

216 Proapoptotic phosphorothioate oligonucleotides such as G3139 (an 18-m

217 e demonstrate the ability of G3139 and other phosphorothioate oligonucleotides to bind directly to mi

218 important degradation pathway for antisense phosphorothioate oligonucleotides under conditions of th

219 8-58), Penetratin and R9 conjugates of 16mer phosphorothioate OMe oligonucleotide.

220 ckbone linkages at each nucleotide: 1), [Rp]-phosphorothioate or 2), [Sp]-phosphorothioate.

221 found to enhance triplex formation, whereas phosphorothioate or phosphotriester substitutions abroga

222 on of all four nucleotide triphosphates with phosphorothioates or the substitution of one with the eq

223 uanine-containing S-oligomers containing one phosphorothioate, -P-S-Cl results in one-electron oxidat

224 ld change in (31)P NMR chemical shift of the phosphorothioate peak (Delta approximately 3 ppm with 6

225 tives with thiols, beta-thioglycosyl thiols, phosphorothioates, phosphates, and amines to afford comp

226 Binding and kinetic data with the phosphorothioates/phosphorothiolate indicate that the tw

227 trophenyl phosphate (pNPP) and p-nitrophenyl phosphorothioate (pNPPT), from water to 0.6 (mol) aq DMS

228 An 8-mer phosphorothioate, polydeoxythymidine, induces partial bl

229 es that are linked to chemically substituted phosphorothioate positions at the DNA backbone.

230 When a nucleophilic phosphorothioate probe binds adjacent to a dabsyl quench

231 e probe pairs consisted of a nucleophilic 3'-phosphorothioate probe carrying a Cy5 FRET acceptor, and

232 ilic displacement of the dabsyl probe by the phosphorothioate probe.

233 Here, a modified ASA termed phosphorothioate proofreading allele-specific amplificat

234 Phosphorothioate (PS) antisense oligonucleotides (ASOs)

235 Major modifications include phosphorothioate (PS) backbone and different 2'-modifica

236 Phosphorothioate (PS) backbone modification of nucleotid

237 Ligands with phosphorothioate (PS) backbones induce the formation of

238 uction of beta-chemokines by non-CpG-ODN was phosphorothioate (PS) chemistry dependent and inhibited

239 The addition of phosphorothioate (PS) groups to natural phosphodiester (

240 isense oligonucleotides (ASOs) modified with phosphorothioate (PS) linkages and different 2' modifica

241 Antisense oligonucleotides (ASOs) with phosphorothioate (PS) linkages are broadly used as resea

242 ASOs modified with phosphorothioate (PS) linkages enter cells via endocytot

243 tion studies of HHRz constructs containing a phosphorothioate (PS) modification at the cleavage site.

244 In this work, phosphorothioate (PS) modifications were systematically

245 echanism based on Hg(2+)-induced cleavage of phosphorothioate (PS) modified RNA.

246 by directly comparing the ability of OXE and phosphorothioate (PS) ODNs to target c-myb gene expressi

247 Phosphodiester (PO) and phosphorothioate (PS) oligonucleotides (ODNs) (15 nucleo

248 In this work, a phosphorothioate (PS) RNA-containing library was used fo

249 We demonstrate that phosphorothioate (PS) stereochemistry substantially affe

250 Phosphorothioate (PS)-modified antisense oligonucleotide

251 Both normal DNA and phosphorothioate (PS)-modified DNA are tested for this p

252 ne monomers were used to prepare a series of phosphorothioate (PS)-modified gapmer antisense oligonuc

253 Lipofectamine 2000-mediated transfection of phosphorothioate (PS)-modified oligonucleotides (ON) on

254 t the evaluation of 20-, 18-, 16- and 14-mer phosphorothioate (PS)-modified tricycloDNA (tcDNA) gapme

255 confirmation rate during screening of fully phosphorothioated (PS)-LNA gapmer ASOs designed against

256 to RNA relative to the first-generation DNA phosphorothioates (PS-DNA).

257 The GRO29A analogues include phosphorothioate (PS29A), 2'-O-methyl RNA (MR29A), and m

258 Bacterial phosphorothioate (PT) DNA modifications are incorporated

259 DNA phosphorothioate (PT) modification is a sulfur modificat

260 Phosphorothioate (PT) modification of DNA, with sulfur r

261 triction-modification (R-M) system involving phosphorothioate (PT) modification of the DNA backbone.

262 s (lipoplexes) were formulated at a nitrogen:phosphorothioate ratio (N:P) of 2 with a dose concentrat

263 dified regions and a 2'-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of

264 bstrates were synthesized, where an epimeric phosphorothioate replaces one of the phosphate diester l

265 des that terminated with a 5'-iodine and a 3'phosphorothioate, respectively.

266 , inositol 1-phosphorothioate and inositol 6-phosphorothioate, respectively.

267 olino phosphoroamidate (PMO) and 2'-O-methyl phosphorothioate RNA (2'Ome RNA) chemistry have been sho

268 ment of lymphoblast cells with IIS antisense phosphorothioate (S)-oligonucleotides prevents chemotact

269 icient and cost-effective manner to backbone phosphorothioate sites that are chemically substituted i

270 surface of DNA being randomly labeled at the phosphorothioate sites with this protein-cleaving reagen

271 immunostimulatory sequence (ISS)-containing phosphorothioate-stabilized oligonucleotides for antiher

272 eriments using HisRS active site mutants and phosphorothioate-substituted adenylate showed that subst

273 lease and reconstitution of the probe with a phosphorothioate-substituted oligonucleotide, an [alpha-

274 coordinated to the C208 pro-S(P) oxygen, the phosphorothioate-substituted ribozymes were also assayed

275 rates with a 3'-phosphorothiolate or an S(P) phosphorothioate substitution at the scissile phosphate.

276 Only the effect of the C208 S(P) phosphorothioate substitution could be significantly res

277 are kinetically recruited and anchored to a phosphorothioate substitution embedded within a structur

278 Sites in the stem-loop substrate where phosphorothioate substitution impaired reaction cluster

279 When a phosphorothioate substitution is installed at the scissi

280 each of these sites is supported by previous phosphorothioate substitution studies and, in the case o

281 Of the 10 ribozymes that were studied, four phosphorothioate substitutions (A207 S(P), C208 S(P), A3

282 We also show that phosphorothioate substitutions at the cleavage site and

283 caused recovery of the rate of reaction for phosphorothioate substitutions between A621 and A622 and

284 mbined atomic mutagenesis with site-specific phosphorothioate substitutions in the ribozyme backbone

285 m, stereospecific (R(P) or S(P)) single-site phosphorothioate substitutions were introduced at five p

286 rategy based on Pt(II) targeting of specific phosphorothioate substitutions.

287 preferences of AP endo and T4 DNA ligase for phosphorothioate substrates, we show that AP endo acts b

288 hat Mn(2+) or Cd(2+) accelerated cleavage of phosphorothioate substrates.

289 Two nitroxides are attached to phosphorothioates that are chemically substituted at spe

290 ine (R5a), was attached postsynthetically to phosphorothioates that were chemically introduced, one a

291 the solid-phase synthesis of oligonucleoside phosphorothioates, the thermolytic 2-[N-methyl-N-(2-pyri

292 AsTsAsT]2, -P-S-Cl reacts with a neighboring phosphorothioate to form the sigma(2)sigma*(1)-bonded di

293 oligonucleotide with an equivalent number of phosphorothioates to thioaptamer 97 and a scrambled cons

294 microbubble destruction-mediated delivery of phosphorothioated TRAF3IP2 antisense oligonucleotides in

295 rated site-specific delivery of antiparallel phosphorothioate triplex forming oligonucleotide (TFO) s

296 We also synthesized and evaluated the alpha-phosphorothioate variant of d5SICSTP, which provides a r

297 mechanistic difference (D(N) + A(N) for the phosphorothioate versus A(N)D(N) for the phosphate) comp

298 erminus of a nucleic acid, and the resulting phosphorothioate was then reacted with an iodomethyl der

299 s, p-nitrophenyl phosphate and p-nitrophenyl phosphorothioate, were compared to the activation parame

300 Electrophilic addition of Cl2(*-) to phosphorothioate with elimination of Cl(-) leads to the