ライフサイエンスコーパス: solid-phase synthesis

1 yl ring of Phe(3) or Phe(4) were prepared by solid phase synthesis.

2 phosphonium cation via a lysine linker using solid phase synthesis.

3 efined sites were chemically synthesized via solid phase synthesis.

4 ND1 probes as well as mismatched controls by solid-phase synthesis.

5 deglycobleomycin analogues through parallel solid-phase synthesis.

6 tides were incorporated into RNA strands via solid-phase synthesis.

7 to carrier proteins, in a natural analogy to solid-phase synthesis.

8 tterer into oligonucleotides by conventional solid-phase synthesis.

9 ) has been incorporated into a peptide using solid-phase synthesis.

10 hat is suitably protected for utilization in solid-phase synthesis.

11 lly protected furanoid SDAs and their use in solid-phase synthesis.

12 d and incorporated into oligonucleotides via solid-phase synthesis.

13 be directly covalently linked to DNA during solid-phase synthesis.

14 ock copolypeptoids synthesized by submonomer solid-phase synthesis.

15 timate N-terminal position were prepared via solid-phase synthesis.

16 nto an a-factor-derived peptide produced via solid-phase synthesis.

17 ) were incorporated into oligonucleotides by solid-phase synthesis.

18 they are prepared either enzymatically or by solid-phase synthesis.

19 methyluridine were chemically synthesized by solid-phase synthesis.

20 ucleotides with high efficiency via standard solid-phase synthesis.

21 yl)glyc ine) (pNte-b-pNeh), were obtained by solid-phase synthesis.

22 osphoramidites were prepared and employed in solid-phase synthesis.

23 abel for paramagnetic modification of RNA by solid-phase synthesis.

24 to a target RNA via chemical oligonucleotide solid-phase synthesis.

25 s were incorporated into oligonucleotides by solid-phase synthesis.

26 f side chains can be incorporated via facile solid-phase synthesis.

27 g atom into oligonucleotides by conventional solid-phase synthesis.

28 t the 2'-position of uridine by conventional solid-phase synthesis.

29 inker was incorporated into the conjugate by solid-phase synthesis.

30 ection provided building blocks suitable for solid-phase synthesis.

31 longer oligomers and for the development of solid-phase synthesis.

32 beled antimicrobial peptide BODIPY-cPAF26 by solid-phase synthesis (6-7 d) and its spectral and biolo

33 ptide substrates is typically carried out by solid-phase synthesis, a method that is not ideal for pr

34 We developed a strategy based on solid phase synthesis and post-functionalization to intr

35 ocortin 4 receptor (hMC4R), were prepared by solid phase synthesis and were N-terminally acylated wit

36 Here we report the solid-phase synthesis and analysis of peptide-linked, sp

37 cates that well-characterized MAPs combining solid-phase synthesis and conjugation chemistries are po

38 analogues at defined sites were prepared by solid-phase synthesis and in some cases enzymatic ligati

39 ared the putative ancestral human peptide by solid-phase synthesis and named it "retrocyclin." Retroc

40 lic molecules by TE catalysis, we report the solid-phase synthesis and TE-mediated cyclization of a s

41 ite 8b into the oligonucleotide chain during solid-phase synthesis and, optionally, through subsequen

42 nding catechol domains were obtained through solid phase synthesis, and their binding affinity to hyd

43 thesized using standard photolithography and solid-phase synthesis, and is able to sequence >29 kb of

44 The solid-phase synthesis applied here to epothilone A could

45 ucosamine (GlcN sulfoforms) were prepared by solid-phase synthesis as models of internal glucosamines

46 f peptide-based catalysts was synthesized on solid-phase synthesis beads such that each individual be

47 ile (diethylenetriamine) building blocks for solid-phase synthesis bearing Fmoc/Boc and Fmoc/Alloc pr

48 ing peptidomimetic scaffolds are prepared by solid-phase synthesis from a single, versatile class of

49 The highly refined organic chemistry in solid-phase synthesis has made it the method of choice n

50 Although recent advancements in solid-phase synthesis have made the construction of comp

51 The ease of preparation, high affinity of solid-phase synthesised imprinted nanoparticles and the

52 ions were synthesized and introduced through solid-phase synthesis into 15-mer oligodeoxynucleotide,

53 Automated solid-phase synthesis is an attractive technique for the

54 at can be incorporated into a peptide during solid-phase synthesis, is a useful probe for investigati

55 Besides solid-phase synthesis, isotope-labeled peptides are also

56 Incorporation of these monomer units into solid-phase synthesis led to the efficient synthesis of

57 A-DOTA and LLP2A-CB-TE2A were prepared using solid-phase synthesis; LLP2A-DOTA-PEG(2,000), LLP2A-DOTA

58 produced for adenovirus by employing a novel solid phase synthesis method.

59 A highly efficient solid-phase synthesis method for the preparation of fluo

60 the template was investigated using a novel solid-phase synthesis method to obtain the artificial af

61 o the single enantiomers; its application to solid-phase synthesis methodology gave a series of monom

62 Fmoc-based solid-phase synthesis methodology was used to prepare pe

63 dazole polyamides, coupled with an efficient solid-phase synthesis methodology, identify a powerful c

64 hendione metal complexes using combinatorial solid-phase synthesis methodology.

65 s of the approaches presented are the use of solid-phase synthesis methods for the generation of a co

66 ng 9-fluorenylmethyloxycarbonyl (Fmoc)-based solid-phase synthesis; N(alpha)-Fmoc-dl-hydroxy-dl-Lys(N

67 e glycopeptide 1 was synthesized using a new solid phase synthesis of carbohydrates and a convergent

68 This approach was applied to the solid phase synthesis of glycosylated forms of the 34 am

69 three segments due to the current limits of solid phase synthesis of individual peptide segments.

70 Solid phase synthesis of indolicidin gave rise to a mino

71 s study offers a simple designer approach to solid phase synthesis of macrocyclic peptides and lantib

72 escribe a microfluidic platform for parallel solid phase synthesis of oligonucleotides that can great

73 coupling activator during routine automated solid phase synthesis of oligonucleotides.

74 We report here the solid phase synthesis of RNA and DNA oligonucleotides co

75 -dimethoxytrityl)-10-undecenoic acid, to the solid phase synthesis of RNA molecules is described.

76 ual-linker system has been developed for the solid phase synthesis of sterically hindered amides.

77 ether with the Nbz linker for Fmoc chemistry solid phase synthesis of the glycopeptide-(alpha) thioes

78 The solid-phase synthesis of 1,5-disubstituted 2-aryliminoim

79 on a solid support has permitted the facile solid-phase synthesis of 108 unique deglycobleomycin ana

80 A traceless approach for the parallel solid-phase synthesis of 2-arylamino-substituted quinazo

81 are described along with a protocol for the solid-phase synthesis of 21mer alpha PNAs containing fiv

82 to the corresponding phosphoramidite enables solid-phase synthesis of [2'-(18)O] RNA substrates for i

83 The solid-phase synthesis of a 1976-membered library of spir

84 The solid-phase synthesis of a cyclic peptide containing the

85 and bromoacetic acid are used in the facile solid-phase synthesis of a diverse family of sequence-sp

86 affect protein palmitoylation, we report the solid-phase synthesis of a fluorescent cell-permeable pa

87 In a conventional five-step solid-phase synthesis of a hydantoin, similar results we

88 Previously, we described the solid-phase synthesis of a library of 108 unique analogu

89 otocol describes a general procedure for the solid-phase synthesis of a library of N-acyl aminocoumar

90 The parallel, asymmetric solid-phase synthesis of a small library of chiral keton

91 is orthogonally protected lanthionine in the solid-phase synthesis of an analogue of a fragment of ni

92 The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then c

93 We recently optimized the solid-phase synthesis of beta-peptides using microwave i

94 A highly efficient and general solid-phase synthesis of bicyclic pyrimidine derivatives

95 on the mineral surfaces in a manner akin to solid-phase synthesis of biopolymers.

96 Envisioning an automated solid-phase synthesis of blood group determinants, the u

97 We report an efficient solid-phase synthesis of C-terminal tyrosine peptide ald

98 upports will have generic application in the solid-phase synthesis of combinatorial libraries and the

99 The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its

100 The first stepwise solid-phase synthesis of deoxynucleic guanidine (DNG), a

101 Although high-throughput methods for solid-phase synthesis of DNA sequences are currently ava

102 ble with the cleavage conditions used in the solid-phase synthesis of DNA.

103 Here we report the first solid-phase synthesis of epothilone A, the total synthes

104 The solid-phase synthesis of glycopeptides containing the su

105 es has been developed via microwave-assisted solid-phase synthesis of hairpin amino acid oligomer int

106 A method for the solid-phase synthesis of individual cyclic depsipeptides

107 A five-step solid-phase synthesis of isoxazolinopyrrole-2-carboxylat

108 e issues, in the present study we report the solid-phase synthesis of lanthionine-bridged analogues o

109 This manuscript describes the automated, solid-phase synthesis of mixed backbone oligodeoxyribonu

110 This Article describes the automated solid-phase synthesis of mixed-backbone oligodeoxynucleo

111 methylcytidine (hm(5)rC) phosphoramidite for solid-phase synthesis of modified RNA oligonucleotides.

112 anidine protection group greatly facilitates solid-phase synthesis of N,N'-substituted guanidine comp

113 amino acids and demonstrate their use in the solid-phase synthesis of N-amino peptide derivatives.

114 The discovery, structure elucidation, and solid-phase synthesis of namalide, a marine natural prod

115 ucleosides for potential applications in the solid-phase synthesis of native RNA sequences.

116 An efficient approach for the parallel solid-phase synthesis of novel heterocyclic azoniaspiro

117 When employing phosphoramidites 1a-d in the solid-phase synthesis of oligonucleoside phosphorothioat

118 A method for the solid-phase synthesis of oligonucleotides containing C2-

119 ion of several of these phosphoramidites for solid-phase synthesis of oligoribonucleotides containing

120 nmasking of a single hydroxyl group precedes solid-phase synthesis of one arm of the cross-linked DNA

121 e of Fmoc and Alloc protecting groups during solid-phase synthesis of PAAs with backbones differing i

122 ic images of resin particles employed in the solid-phase synthesis of peptide combinatorial libraries

123 One challenge in automated solid-phase synthesis of phosphorothioate-containing RNA

124 re in such a system is reminiscent of modern solid-phase synthesis of polypeptides and polynucleotide

125 esis of NiN2S2 metalloligands, including the solid-phase synthesis of resin-bound Ni(CGC)2-, and sulf

126 ic modifications are typically introduced by solid-phase synthesis of RNA oligonucleotides using nucl

127 lness of this approach is exemplified by the solid-phase synthesis of some derivatives of the natural

128 A divergent solid-phase synthesis of stable-isotope-labeled AHLs sui

129 The synthesis consisted of two key steps: a solid-phase synthesis of the cyclic, 47-mer V3 domain pe

130 The solid-phase synthesis of the deglycobleomycin library pr

131 Finally, solid-phase synthesis of the desired glycopeptides direc

132 l can be divided into three major parts: (i) solid-phase synthesis of the fluorescence-labeled HyCoSu

133 This first solid-phase synthesis of the Leishmania cap provided rap

134 Solid-phase synthesis of the trithiazole deglycoBLM A(5)

135 ynthesis of IGF-1 analogs, which entails the solid-phase synthesis of two IGF-1 precursor chains that

136 of alpha- and beta-Nsmoc amino acids to the solid-phase synthesis of two model peptides was examined

137 We present here the solid-phase synthesis of two novel classes of phosphopep

138 polymers play many roles, from supports for solid-phase synthesis or catalysis to media for separati

139 ed to larger polypeptides produced by either solid-phase synthesis or recombinant techniques and give

140 The solid-phase synthesis plays a critical role in the succe

141 an frequently be synthesized using efficient solid phase synthesis procedures similar to peptide synt

142 he non-native nucleobase was incorporated by solid-phase synthesis produced electrocatalytic signals

143 A solid-phase synthesis protocol for the preparation of pr

144 mimetics obtained by a general monomer-based solid-phase synthesis protocol.

145 Solid-phase synthesis provided 13 analogues, which were

146 The solid-phase synthesis relied on assembly from monosaccha

147 d conjugates were constructed stepwise using solid-phase synthesis starting from immobilized primary

148 Fmoc (9-fluorenylmethoxycarbonyl) protected solid phase synthesis strategy.

149 ligodeoxyribonucleotides were prepared via a solid phase synthesis strategy.

150 te oligodeoxynucleotides were prepared via a solid-phase synthesis strategy.

151 yco-assembly efficiencies than the automated solid-phase synthesis strategy.

152 xyl groups were obtained using a photolabile solid-phase synthesis support (2) and a commercially ava

153 xynucleotide conjugates were prepared on the solid-phase synthesis support following selective unmask

154 '-alkylamines were obtained from photolabile solid-phase synthesis supports (1 and 4).

155 Solid-phase synthesis techniques were used to prepare de

156 sing 9-fluorenylmethoxycarbonyl (Fmoc)-based solid-phase synthesis techniques.

157 mino acid derivatives suitably protected for solid-phase synthesis that give rise to residues contain

158 complex carbohydrate mixture was obtained by solid-phase synthesis, the desired oligosaccharide conta

159 Here, we used solid-phase synthesis to generate a new series of helica

160 selected peptides LDIFSDF and LDIFSDFR, via solid-phase synthesis, to "mimic" the tightly held charg

161 [D-Pro10]Dyn A-(2-11) was prepared by solid phase synthesis using Fmoc-protected amino acids,

162 ing phosphorodithioate linkage via automated solid-phase synthesis using 5'-O-DMTr-2'-O-TBS-ribonucle

163 and optimized to allow efficient and facile solid-phase synthesis using phosphoramidite chemistry.

164 1 was also prepared by solid-phase synthesis, using the acid-sensitive 2-chloro

165 Solid-phase synthesis was employed to prepare linear ant

166 Translation to solid-phase synthesis was facilitated by the use of a te

167 Solid-phase synthesis was used to generate benzylamides

168 MN10021, prepared by solid-phase synthesis, was dimerized through a naturally

169 ticularly those that need to be generated by solid phase synthesis with chemical addition of end-bloc

170 nanoparticles, prepared in aqueous media by solid phase synthesis with immobilised L-thyroxine, gluc

171 NC-1059 peptide was synthesized by solid-phase synthesis with 9-fluorenylmethoxycarbonyl ch

172 horamidite and incorporated it into DNAs via solid-phase synthesis with a coupling yield over 97%.

173 ligosaccharides in solution and by automated solid-phase synthesis with glycosyl phosphate building b

174 Solid-phase synthesis with N(alpha)-9-fluorenylmethyloxy

175 defined poly/oligo(amidoamines) (PAAs) using solid-phase synthesis with the capability of introducing

176 pects the favorable purification features of solid-phase synthesis with the favorable reaction, ident