ライフサイエンスコーパス: filamentous fungi

1 avenues for research on the morphogenesis of filamentous fungi.

2 ceptible to natamycin when compared to other filamentous fungi.

3 are produced by several genera of yeast and filamentous fungi.

4 a major antigenic determinant of yeasts and filamentous fungi.

5 ealed a powerful antifungal activity against filamentous fungi.

6 but have yet to be found in human-pathogenic filamentous fungi.

7 tools to further study telomere dynamics in filamentous fungi.

8 ues against strains of pathogenic yeasts and filamentous fungi.

9 ersity in the more-than-a-million species of filamentous fungi.

10 which could be applied to other cellulolytic filamentous fungi.

11 antitative and qualitative identification of filamentous fungi.

12 s is the first study of an Rtf1 like gene in filamentous fungi.

13 ariable use of a common signalling module in filamentous fungi.

14 st complete telomere-to-telomere genomes for filamentous fungi.

15 life histories of many organisms, including filamentous fungi.

16 r the synthesis of antibiotics and toxins in filamentous fungi.

17 they are only beginning to be understood in filamentous fungi.

18 enzyme mixtures and from the genomes of most filamentous fungi.

19 tip growth as the primary mode of growth in filamentous fungi.

20 g pathways that regulate septum formation in filamentous fungi.

21 he simpler glycosphingolipid compositions of filamentous fungi.

22 sults expand the repertoire of small RNAs in filamentous fungi.

23 on hyphal self-signalling and self-fusion in filamentous fungi.

24 ir relation to the cortex between yeasts and filamentous fungi.

25 ay principally be conserved from S. pombe to filamentous fungi.

26 ature are the indefinitely growing hyphae of filamentous fungi.

27 ry proteins in Aspergillus species and other filamentous fungi.

28 rmining the posaconazole susceptibilities of filamentous fungi.

29 osaconazole against 146 clinical isolates of filamentous fungi.

30 behave as prions are also found in yeast and filamentous fungi.

31 contributing to the fecundity and fitness of filamentous fungi.

32 road conservation of rhythmicity amongst the filamentous fungi.

33 dispersal, and integration in the genomes of filamentous fungi.

34 in regulating growth and differentiation in filamentous fungi.

35 vity occurred with other medically important filamentous fungi.

36 in vivo study of truncated gene products in filamentous fungi.

37 sition system for genome wide mutagenesis in filamentous fungi.

38 ome in vitro activity against selected other filamentous fungi.

39 ance transport of vesicles/organelles in the filamentous fungi.

40 ssociated with vegetative incompatibility in filamentous fungi.

41 r comparative analysis with plant pathogenic filamentous fungi.

42 for large-scale analysis of gene function in filamentous fungi.

43 rmants with efficiencies comparable to other filamentous fungi.

44 sceptibilities of Aspergillus spp. and other filamentous fungi.

45 f hyphal tip growth and nuclear migration in filamentous fungi.

46 ate been implicated in the mating process of filamentous fungi.

47 dically important yeasts and especially from filamentous fungi.

48 steps of the shikimate pathway in yeast and filamentous fungi.

49 ields of heterologous proteins secreted from filamentous fungi.

50 for the antifungal susceptibility testing of filamentous fungi.

51 al blood cultures were positive for yeast or filamentous fungi.

52 ell tip and undergoing branching, similar to filamentous fungi.

53 tic gene cluster (BGC) is broadly present in filamentous fungi.

54 as thought to be a strictly asexual genus of filamentous fungi.

55 ic enzyme secretion by industrially relevant filamentous fungi.

56 ing pathways of lignocellulolytic enzymes in filamentous fungi.

57 rmined toxicity against bacteria, yeasts and filamentous fungi.

58 tered pathways for specialized metabolism in filamentous fungi.

59 ristics of this method for identification of filamentous fungi.

60 tency against a broad range of dimorphic and filamentous fungi.

61 tB comprise a regulatory pathway specific to filamentous fungi.

62 se to oxidative stress in humans, yeast, and filamentous fungi.

63 GprH appears conserved throughout numerous filamentous fungi.

64 erstanding of BI-1-like protein functions in filamentous fungi.

65 cteria and yeast but excluding anaerobes and filamentous fungi.

66 and clinical biofilms involving bacteria and filamentous fungi.

67 antifungal activity against a broad range of filamentous fungi.

68 amics and unidirectional hyphal expansion in filamentous fungi.

69 lication as a tool in functional genomics of filamentous fungi.

70 connected mycelial network characteristic of filamentous fungi.

71 onas algal cells physically interacting with filamentous fungi.

72 , Aspergillus (54 patients [17%]), and other filamentous fungi (141 patients [43%]).

73 frequently isolated (23, 67.6%), among which filamentous fungi (25, 39.1%) and coagulase-negative sta

74 intenance genes often lead to a split tip in filamentous fungi, a phenotype without an analogue in ye

75 Two filamentous fungi (Actinomucor elegans and Umbelopsis is

76 Here we show that filamentous fungi and a number of bacteria possess a div

77 These proteins occur only in filamentous fungi and are associated with the induction

78 Filamentous fungi and bacteria form mixed-species biofil

79 To disperse their spores to new sites, filamentous fungi and bacteria need to erect aerial fila

80 e mRNAs bound to PUF proteins in budding and filamentous fungi and by computational analyses of ortho

81 s (NCCLS) for broth microdilution testing of filamentous fungi and by the NCCLS M27-A broth microdilu

82 itization to thermotolerant fungi, including filamentous fungi and Candida albicans, is associated wi

83 ther-bud neck of yeast, and branch points of filamentous fungi and dendritic spines, in cleavage furr

84 ites, the majority of which were specific to filamentous fungi and distributed throughout the CrzA pr

85 Specifically, free-living filamentous fungi and ectomycorrhizal fungi responded po

86 y belong to a class of proteins specific for filamentous fungi and function as novel virulence factor

87 .6-40% smaller than those of closely related filamentous fungi and has undergone significant gene los

88 vegetative incompatibility is ubiquitous in filamentous fungi and is genetically regulated by het lo

89 imilarity to a small group of sequences from filamentous fungi and no significant similarity to 1,3-b

90 lude hyphal tip growth in actinobacteria and filamentous fungi and pollen tube development.

91 homologs that includes representatives from filamentous fungi and protists.

92 s may be important in nonself recognition in filamentous fungi and that proteins containing a HET dom

93 es predates the origin of budding yeasts and filamentous fungi and was maintained for 500 million yea

94 entous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant

95 etabolic pathways are common in bacteria and filamentous fungi, and examples have now been discovered

96 triggers crucial developmental processes in filamentous fungi, and opens new avenues for research on

97 (MUB) proteins that are present in animals, filamentous fungi, and plants.

98 sms that operate during vegetative growth in filamentous fungi, and provides a model for investigatin

99 and temporal segregation of Type4-ATPases in filamentous fungi, and the asymmetric distribution of ph

100 es have been detected in all major groups of filamentous fungi, and their study represents an importa

101 ts with keratitis is different for bacteria, filamentous fungi, and yeasts.

102 mystery of possible mating type switching in filamentous fungi; and finally the evolutionary origins

103 Germ tube emergence in filamentous fungi appears to be similar to bud emergence

104 Filamentous fungi are a common cause of blindness and vi

105 Filamentous fungi are a large group of diverse and econo

106 Filamentous fungi are a rich source of bioactive compoun

107 These results show that filamentous fungi are capable of producing a heterogeneo

108 Filamentous fungi are critical in the transition to a mo

109 Allorecognition processes in filamentous fungi are essential to ensure identity of an

110 Filamentous fungi are ideal systems to study the process

111 ogical features associated with apoptosis in filamentous fungi are induced by various stresses and dr

112 athways controlling cell wall composition in filamentous fungi are largely unknown.

113 Filamentous fungi are multicellular eukaryotic organisms

114 Filamentous fungi are native secretors of lignocelluloly

115 Filamentous fungi are powerful producers of hydrolytic e

116 Filamentous fungi are renowned for the production of bio

117 Filamentous fungi are ubiquitous organisms and major pla

118 atanin proteins (CPs), which are secreted by filamentous fungi, are phytotoxic to host plants, but th

119 that will underpin the more efficient use of filamentous fungi as cell factories in food has increase

120 h other adenylate cyclase genes from several filamentous fungi as well as yeasts.

121 The filamentous fungi Aspergillus nidulans and Neurospora cr

122 oformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium so

123 mechanisms of lead tolerance of two typical filamentous fungi, Aspergillus niger and Penicillium oxa

124 s broad-spectrum antifungal activity against filamentous fungi at submicromolar concentrations.

125 un (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filame

126 When the spores of filamentous fungi break dormancy, they grow isotropicall

127 ases are important for hyphal growth in some filamentous fungi but are not found in yeasts.

128 human-pathogenic yeasts and plant-pathogenic filamentous fungi but have yet to be found in human-path

129 orthologs of BI-1 are widely distributed in filamentous fungi but their functions remain largely unk

130 d characterized in a fungus and is unique to filamentous fungi, but homologous genes in Magnaporthe,

131 mponents is critical for hyphal formation in filamentous fungi, but the mechanisms responsible for po

132 boswitch and motifs suggesting regulation in filamentous fungi by Puf family genes.

133 Filamentous fungi can also undergo hyphal fusion with di

134 Traditional methods for identification of filamentous fungi can be slow and may lack resolution.

135 Among filamentous fungi capable of mycelial growth, het genes

136 in pyridoxine (vitamin B6) metabolism in the filamentous fungi Cercospora nicotianae and in Aspergill

137 In filamentous fungi, chromatin modifications regulate seco

138 Filamentous fungi colonise substrates by invasive growth

139 The hyphal cells of filamentous fungi concentrate both exocytosis and endocy

140 dent nucleators of actin polymerization, and filamentous fungi contain a single formin that localizes

141 5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn

142 These include yeast, filamentous fungi, cultivated mushrooms and human cultur

143 ls are found in diverse contexts and include filamentous fungi, developing insect embryos, skeletal m

144 Filamentous fungi differentiate along complex developmen

145 f 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from

146 These telomerase RNAs identified from filamentous fungi display conserved structural elements

147 Yeasts and filamentous fungi do not have adenosine deaminase acting

148 ent for antifungal susceptibility testing of filamentous fungi does not describe guidelines for echin

149 e susceptibility testing of conidium-forming filamentous fungi does not explicitly address the testin

150 A standard for the susceptibility testing of filamentous fungi does not specifically address the test

151 taxa to functional groups (e.g., free-living filamentous fungi, ectomycorrhizal fungi, and yeasts) ba

152 Filamentous fungi elaborate a complex array of secondary

153 alkaloids, secondary metabolites produced by filamentous fungi, elicit a diverse array of pharmacolog

154 DNA sequencing kit for the identification of filamentous fungi encountered in the mycology laboratory

155 3) The coregulated Puf4 target set in filamentous fungi expanded to include mitochondrial gene

156 Airborne spores (conidia) of these filamentous fungi express a surface protein that confers

157 RNA viruses of filamentous fungi fall into two broad categories, those

158 Rational engineering of filamentous fungi for improved cellulase production is h

159 etes with other epiphytic organisms, such as filamentous fungi, for resources.

160 Filamentous fungi form multicellular hyphae that are par

161 gal culture was focused towards detection of filamentous fungi from sputum samples.

162 The isolation rate of filamentous fungi from sputum was higher in children wit

163 e test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical spe

164 ostamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent.

165 yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among r

166 also expanded and diversified its targets in filamentous fungi, gaining interactions with the mRNAs e

167 Filamentous fungi grow as a multicellular, multinuclear

168 Filamentous fungi grow as multinucleate hyphal tubes tha

169 Ten species of filamentous fungi grown in submerged flask cultures were

170 In filamentous fungi, growth polarity (i.e. hyphal extensio

171 f multiple triazole resistance in pathogenic filamentous fungi has become an increasing clinical conc

172 Antifungal susceptibility testing of filamentous fungi has become more important given the re

173 Protein secretion in filamentous fungi has been shown to be restricted to act

174 ombination exhibited by wild-type strains of filamentous fungi has hindered development of high-throu

175 mall-molecule biosynthetic potential of most filamentous fungi has remained largely unexplored and re

176 portion of the hyphal tip, and suggest that filamentous fungi have evolved a novel strategy for pola

177 Proteomic studies of filamentous fungi have only recently begun to appear in

178 oviruses, which are ubiquitously detected in filamentous fungi, have the simplest RNA genomes of 2.2

179 pproach to develop a better understanding of filamentous fungi, highlighting sample preparation metho

180 In filamentous fungi, hyphal growth depends on the continuo

181 , Aspergillus in 17 samples (24%), and other filamentous fungi in 19 samples (27%) and showed negativ

182 first report of heterotrimeric G proteins in filamentous fungi in 1993, it has been demonstrated that

183 sequencing assay for rapid identification of filamentous fungi in formalin-fixed paraffin-embedded (F

184 nfocal microscopy (LS-IVCM) for detection of filamentous fungi in patients with microbial keratitis a

185 The filamentous fungi in the genus Aspergillus are opportuni

186 The cells walls of filamentous fungi in the genus Aspergillus have galactof

187 tems against a number of Candida species and filamentous fungi in their planktonic and biofilm phenot

188 IgE sensitisation to thermotolerant filamentous fungi, in particular A. fumigatus but not to

189 carcinogenic polyketide produced by several filamentous fungi including Aspergillus nidulans.

190 with a mycelial lifestyle similar to that of filamentous fungi, including extreme cell and growth pol

191 s growth inhibitory activity against several filamentous fungi, including Fusarium oxysporum.

192 y metabolites produced by multiple genera of filamentous fungi, including many plant pathogenic speci

193 Sexual reproduction in filamentous fungi, including mating strategy (self-ferti

194 Conidiation in filamentous fungi involves many common themes including

195 porulation (conidiation) in the ascomycetous filamentous fungi involves the formation of conidia, for

196 ations suggests that nuclear distribution in filamentous fungi is a process that is easily disrupted

197 Nonself recognition in filamentous fungi is conferred by genetic differences at

198 ests that the secondary metabolite wealth of filamentous fungi is largely untapped.

199 ever, knowledge in simple eukaryotes such as filamentous fungi is limited.

200 self recognition during vegetative growth in filamentous fungi is mediated by heterokaryon incompatib

201 Biodeterioration caused by filamentous fungi is often a threat to the architectural

202 A hallmark of filamentous fungi is the class V chitin synthase, which

203 Remarkably, filamentous fungi lack the equivalent of the yeast vacuo

204 Calcium signalling is little understood in filamentous fungi largely because easy and routine metho

205 -built database was combined with the Bruker Filamentous Fungi Library compared with that for the Bru

206 In Neurospora crassa and other filamentous fungi, light-dependent-specific phenomena ar

207 Filamentous fungi, like bacteria were capable of forming

208 d subapical branching, but in both processes filamentous fungi maintain several axes of polar growth

209 emphasizes that phenotypic identification of filamentous fungi may not identify morphologically simil

210 ependent ceramide synthase that is unique to filamentous fungi mediates the effects of HSAF.

211 In this organism, as in other filamentous fungi, microtubules have been implicated in

212 are available for susceptibility testing of filamentous fungi (molds) to antifungal agents, quality

213 ivities (MICs) of established agents against filamentous fungi (molds).

214 life, including the ubiquitous and versatile filamentous fungi (molds).

215 ivities (MICs) of established agents against filamentous fungi (molds); however, standard conditions

216 Filamentous fungi (moulds) are ubiquitous soil inhabitan

217 In addition, in filamentous fungi, MTs could provide the tracks for long

218 sion of these mRNAs upon deletion of Puf4 in filamentous fungi (N. crassa) in contrast to the increas

219 in VVD regulates blue light responses in the filamentous fungi Neurospora crassa.

220 In filamentous fungi, NOX enzymes are involved in signaling

221 oinvasive infection caused by the ubiquitous filamentous fungi of the Mucorales order of the class of

222 ucormycosis, an invasive infection caused by filamentous fungi of the order Mucorales.

223 In filamentous fungi of the subphylum Pezizomycotina, 5S rR

224 iversal or the mitochondrial genetic code of filamentous fungi, one strand of M2 encodes a putative p

225 In filamentous fungi, organization of the Golgi apparatus r

226 However, the functions of Sch9 orthologs in filamentous fungi, particularly in pathogenic species, h

227 ore than 30 microorganisms, including yeast, filamentous fungi, pathogens, and marine-derived bacteri

228 tes as a functional amyloid aggregate in the filamentous fungi Podospora anserina, and is involved in

229 hildren were associated with the presence of filamentous fungi positive sputum culture.

230 Our results suggest that filamentous fungi possess distinct pools of ceramide tha

231 Filamentous fungi possess extremely short and tightly re

232 Filamentous fungi present an important clade of microbes

233 ion of sterile and/or arthroconidium-forming filamentous fungi presumed to be basidiomycetes based up

234 Programmed cell death (PCD) in filamentous fungi prevents cytoplasmic mixing following

235 Filamentous fungi produce a diverse array of secondary m

236 Filamentous fungi produce a vast array of secondary meta

237 Filamentous fungi produce a vast array of small molecule

238 ne, and the other (a in yeasts and MAT1-2 in filamentous fungi) produces a peptide pheromone conjugat

239 s: one (called alpha in yeasts and MAT1-1 in filamentous fungi) produces a small, unmodified, peptide

240 Filamentous fungi provide excellent systems for investig

241 incidence of invasive disease attributed to filamentous fungi, rapid and accurate species-level iden

242 A total of 234 filamentous fungi recovered from clinical specimens were

243 te of the economic and medical importance of filamentous fungi, relatively little is known about the

244 system is conserved in the highly polarized filamentous fungi remains unknown.

245 2) In filamentous fungi, remarkably, more than 150 of the ance

246 Hyphal growth of filamentous fungi requires microtubule-based long-distan

247 Mycoprotein is a food ingredient from filamentous fungi rich in protein and fibre.

248 iomass utilization have been identified, how filamentous fungi sense and integrate nutritional inform

249 ever, the means by which N. crassa and other filamentous fungi sense the presence of cellulose in the

250 In filamentous fungi, several lines of experimental evidenc

251 Plants and filamentous fungi share with mammals enzymes responsible

252 several pathways for small RNA production in filamentous fungi, shedding light on the diversity and e

253 In filamentous fungi, somatic cell fusion occurs during veg

254 The aspergilli comprise a diverse group of filamentous fungi spanning over 200 million years of evo

255 32%) and Fusarium (26%) were the most common filamentous fungi species.

256 ity or resistance of 25 clinical isolates of filamentous fungi such as Aspergillus fumigatus to ampho

257 role in the development and pathogenicity of filamentous fungi such as the rice blast fungus (Magnapo

258 Filamentous fungi, such as Neurospora crassa, are very e

259 RIC8 is present in animals and filamentous fungi, such as the model eukaryote Neurospor

260 lation-level genomic studies in a variety of filamentous fungi suggest that nuclear exchange between

261 Data from filamentous fungi suggest that, even when bathed in a co

262 Both media supported the growth of all filamentous fungi tested.

263 and 10(7) CFU were significantly greater for filamentous fungi than for yeasts by the HSCD extraction

264 alcohol were higher (15-30mm) in the case of filamentous fungi than those for the parent compounds.

265 regulatory network is different with Puf4 in filamentous fungi than with Puf3 in budding yeast.

266 Filamentous fungi that colonize microenvironments, such

267 Fusarium is a genus of filamentous fungi that contains many agronomically impor

268 In syncytial filamentous fungi, the acquisition of multicellularity i

269 In filamentous fungi, the actin cytoskeleton is required fo

270 In filamentous fungi, the protective function of RNAi in th

271 In filamentous fungi, the stabilization of a polarity axis

272 h the microfluidic device is demonstrated on filamentous fungi, the technology is immediately extensi

273 subunits are not essential for viability in filamentous fungi, their loss results in an organism tha

274 ite syntheses in several mycotoxin producing filamentous fungi, these effects are associated with gro

275 ungal group including yeasts, mushrooms, and filamentous fungi-these findings suggest that turgor pre

276 vailable for testing the susceptibilities of filamentous fungi to antifungal agents by the Clinical a

277 ic gene homologues in organisms ranging from filamentous fungi to Drosophila melanogaster and Caenorh

278 The ability of filamentous fungi to form hyphae requires the establishm

279 the response of biotechnologically important filamentous fungi to glucose.

280 e panels for measuring the susceptibility of filamentous fungi to posaconazole.

281 nce method for testing the susceptibility of filamentous fungi to posaconazole; agreement (+/-2 log2

282 s vegetative incompatibility operate in many filamentous fungi to regulate hyphal fusion between gene

283 In higher plants, mammals, and filamentous fungi, transcriptional gene silencing is fre

284 nces in global gene expression as pathogenic filamentous fungi undergo forward and reverse morphologi

285 ortant species including mammalian cells and filamentous fungi using both environmental manipulation

286 discovery of TERs from twelve other related filamentous fungi using comparative genomic analysis.

287 CCLS) for broth microdilution testing of the filamentous fungi (visual MICs) and the NCCLS M27-A brot

288 ole susceptibility testing of 50 isolates of filamentous fungi was assessed in comparison with the Na

289 proteins regulate cellular morphogenesis in filamentous fungi, we have characterized homologues of B

290 established knowledge in other, well-studied filamentous fungi, we identify critical knowledge gaps a

291 is and localization of cell wall material in filamentous fungi, we screened a collection of temperatu

292 Twenty-seven different taxa of filamentous fungi were isolated from 54% of their sputa,

293 microg/ml), while the MIC ranges of AMN for filamentous fungi were species specific.

294 ures: late Golgi (trans-Golgi equivalents of filamentous fungi), which are concentrated just behind t

295 tabolites are key signals for sporulation in filamentous fungi, which are communicated through an evo

296 Filamentous fungi with non-septate hyphae were presumpti

297 ly segregated at the ends of hyphal cells of filamentous fungi, with a collar of endocytic activity e

298 Filamentous fungi within the Fusarium graminearum specie

299 Numerous disparate studies in plants, filamentous fungi, yeast, Archaea, and bacteria have ide

300 nction and an IgE fungal panel to colonising filamentous fungi, yeasts and fungal aeroallergens were